ID: 1198746146

View in Genome Browser
Species Human (GRCh38)
Location X:139892583-139892605
Sequence CCTTTTATGGGTACAATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198746146_1198746155 16 Left 1198746146 X:139892583-139892605 CCAACCATTGTACCCATAAAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1198746155 X:139892622-139892644 ACAGAGTAAGGACCAGTTTCTGG 0: 1
1: 0
2: 1
3: 14
4: 217
1198746146_1198746154 4 Left 1198746146 X:139892583-139892605 CCAACCATTGTACCCATAAAAGG 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1198746154 X:139892610-139892632 CACAGGGGATAAACAGAGTAAGG 0: 1
1: 0
2: 0
3: 8
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198746146 Original CRISPR CCTTTTATGGGTACAATGGT TGG (reversed) Intronic
904465718 1:30706204-30706226 CCTTTTCTTGGAACAATGCTTGG + Intergenic
904691814 1:32298669-32298691 CCTATTATGAGAACAATGATGGG + Intronic
908644587 1:66263792-66263814 CCTTTGATGGGTAGATTGTTTGG + Intronic
910863455 1:91765602-91765624 CCTTTTATGGTTCCCATGGATGG - Intronic
916271156 1:162943136-162943158 GCTGTTCTGGGTACAATGGGTGG + Intergenic
919027657 1:192198464-192198486 CTTCTAATGGGTACAAGGGTGGG + Intergenic
919160143 1:193818699-193818721 TCTTATATGGGTGCAATTGTTGG + Intergenic
920925208 1:210334596-210334618 CCTTCTGTGGGTAATATGGTTGG + Intronic
1068447714 10:57144378-57144400 CTTGTAAAGGGTACAATGGTGGG - Intergenic
1070403444 10:76073993-76074015 GCTTTTATAGGTAGAATGATTGG - Intronic
1071801942 10:89073332-89073354 CCATGTTTGGGTACAGTGGTAGG - Intergenic
1073307416 10:102514339-102514361 CCTTTTAGGGTTACCAGGGTGGG - Intronic
1079675064 11:23216971-23216993 CTTTTTATGAGGACAATGCTTGG + Intergenic
1083737720 11:64691183-64691205 CCTTTTGTAGGCACAATGGTGGG - Intronic
1084414538 11:69023729-69023751 GTTTCTAGGGGTACAATGGTGGG - Intergenic
1086263816 11:84973907-84973929 GCTTTTATGGTTTAAATGGTTGG - Intronic
1087404171 11:97709194-97709216 CCTGGTATGAGTACAATGGCTGG - Intergenic
1088102481 11:106170528-106170550 CCTATTATGGTTACAAAGGGAGG + Intergenic
1089766729 11:120773230-120773252 CATTTGATGGGTACAAGGGTGGG - Intronic
1090490272 11:127154598-127154620 CCTTTCATAGATACAGTGGTGGG - Intergenic
1093297604 12:17410494-17410516 CCTTTTAAGGGCACTCTGGTTGG - Intergenic
1093559327 12:20519365-20519387 ACTTTTATGTCTACAATGCTTGG + Intronic
1099055764 12:77838216-77838238 GCTTTTGTGGTAACAATGGTCGG + Intronic
1109743396 13:66586483-66586505 GCTGTTATGGCTAGAATGGTTGG + Intronic
1111466609 13:88621658-88621680 CTCTTTATGGGTACAATATTTGG - Intergenic
1116983266 14:51193427-51193449 TCTTTTCTGGGTAAAGTGGTTGG + Intergenic
1119467397 14:74869678-74869700 TCTTTTATAGATACATTGGTAGG - Intronic
1124240079 15:28021317-28021339 CCTTTTCTGGGTGAAAGGGTGGG - Intronic
1126558596 15:50018697-50018719 CCATTTATGGGGACAAAGCTTGG - Intronic
1138295149 16:55879243-55879265 ACTGTTAGGGGTACAGTGGTAGG - Intronic
1139101919 16:63777829-63777851 ATTTTTATGGATAAAATGGTTGG - Intergenic
1148955206 17:51347826-51347848 CCTTTTCAGGGTAGATTGGTGGG + Intergenic
1149588915 17:57813072-57813094 TTATTTATGGGTACAATGATAGG + Intergenic
1149639376 17:58193110-58193132 CCTCTTCTGGGTCCAATTGTAGG - Exonic
1149977619 17:61282401-61282423 CCTTTTAAGAGTAGGATGGTTGG + Intronic
1151533227 17:74721100-74721122 CTTTTTATGGGTACAGGGCTGGG + Intronic
1153156851 18:2159559-2159581 CCTTTTCTGGTGAAAATGGTTGG - Intergenic
1155376293 18:25161407-25161429 CTTTTTATGGACACAATGGAGGG + Intronic
1159090295 18:63840835-63840857 CCTTTTATAGGTGGAAAGGTTGG - Intergenic
1161650692 19:5482695-5482717 ACTTTTCTGGGTACAAGGCTGGG - Intergenic
1163765545 19:19161307-19161329 CCTTGTATGGGCATAATGGGAGG + Intronic
927262231 2:21102987-21103009 CTTTTTATGGGTACAGGGTTGGG + Intergenic
937149297 2:119674791-119674813 CCATTTATGGGCACAATTGTGGG + Intergenic
940497513 2:154452097-154452119 CTTTTTATTGGTACAACTGTAGG + Exonic
941268132 2:163389872-163389894 CCATTTATGGGCACAGAGGTTGG - Intergenic
1169544615 20:6637792-6637814 CCTCTTGTGGGTGCAATGCTTGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171336794 20:24392606-24392628 CCTTCTATGAGTAAAATTGTTGG - Intergenic
1173613038 20:44384888-44384910 CCTTTTCTGGGAACAAATGTTGG - Intronic
1178475451 21:32933589-32933611 CCTGTTATGGTTACAATCCTAGG - Intergenic
1178691810 21:34755958-34755980 CCTTTTATAGGTTGCATGGTGGG + Intergenic
1178709500 21:34902359-34902381 CCTTAAATGTGGACAATGGTGGG + Intronic
1181666575 22:24402413-24402435 CCTTTTCTGTGTAGTATGGTGGG - Intronic
1182098884 22:27644287-27644309 CCTTTTATGGATACACGCGTAGG + Intergenic
1182714446 22:32345706-32345728 CCTTTTCTGTGTACAGTGATGGG - Intergenic
1184716513 22:46285458-46285480 CCTATGATGGGGACAGTGGTTGG + Intronic
949310223 3:2689202-2689224 CATTTTCTGTGTACAATGCTAGG - Intronic
952310080 3:32180767-32180789 CCTTTTGTGGATACAAAGGGTGG - Intergenic
955104104 3:55879568-55879590 TCATTTCTGGGTACCATGGTTGG - Intronic
955319161 3:57961917-57961939 CCTTGCATGGGTACATTGGCTGG - Intergenic
957586561 3:82139584-82139606 GCTTTTATGGGTACAAGGTGGGG + Intergenic
961971691 3:130975111-130975133 CCTTTTATGTGTGGGATGGTGGG + Intronic
965124611 3:164609692-164609714 ACTTTTATAGGTACAATGTAAGG - Intergenic
971673107 4:29590236-29590258 TCTTTTGTGTGTACAATGTTTGG + Intergenic
972427500 4:38947818-38947840 TCTTTTATGGGAAGAATGGCTGG - Intergenic
974080268 4:57205087-57205109 CCTTTTGTAGGTATATTGGTAGG - Intergenic
975682860 4:76894573-76894595 CTTTTTATGAGTACAAACGTTGG + Intergenic
976088061 4:81426352-81426374 TCTTTTATGGGTGGAATTGTTGG - Intergenic
978568268 4:110108335-110108357 CCCTTTATGGCTAGAATGATAGG - Intronic
979490661 4:121323667-121323689 CATTTTATTGGTGAAATGGTAGG - Intergenic
979574401 4:122270834-122270856 CTTTTTATGAGTTCAAAGGTGGG - Intronic
982685339 4:158482166-158482188 CCCTTTATGGGGACAGGGGTAGG + Intronic
983106260 4:163690526-163690548 ACTTTTATGTGAACAATGTTTGG - Intronic
991308915 5:65213140-65213162 CATTTTATGTGTAAAATGGCTGG - Intronic
997370515 5:133356825-133356847 ACTTTTATGGGGACAATGCTGGG + Intronic
998831468 5:146164008-146164030 CCTTATATGGGTACAGTGTGTGG + Intronic
1003682658 6:8271402-8271424 CCTTGTATGGGAACAATGGCTGG + Intergenic
1005413212 6:25572895-25572917 CCCTTTTTGGTAACAATGGTTGG + Intronic
1005670763 6:28104466-28104488 CCATTTATGGTTACAGTGATTGG + Intergenic
1009942823 6:70308712-70308734 CCTGGTATGGGCACAATAGTTGG + Intergenic
1011229283 6:85141754-85141776 CCTATTGTGGTTACAGTGGTGGG + Intergenic
1016949728 6:149567294-149567316 CCTTTTTTCAGTAGAATGGTAGG + Intronic
1020861475 7:13497128-13497150 CCTTCTATGGTTACAGTGCTAGG - Intergenic
1027812469 7:82922205-82922227 CCTTTGCTGGGTCAAATGGTAGG - Intronic
1028770262 7:94611505-94611527 CTTCTAATGGGTACAAGGGTGGG + Intronic
1028945816 7:96578895-96578917 CATTTTATGGATACAATTATTGG + Intronic
1031448616 7:121885951-121885973 CCTTTTATGGTGACATGGGTTGG + Intronic
1046791575 8:118327768-118327790 CCTTTTATTGGCAGAAGGGTGGG + Intronic
1047242734 8:123107622-123107644 CCTTTTCTGGGAAAACTGGTGGG + Intronic
1051798350 9:20902130-20902152 ACTGTTATGGGTACCATGGGAGG + Intronic
1055402566 9:75940078-75940100 CCTTTTAGAAGTACAATGGATGG - Intronic
1059703286 9:116796363-116796385 CCTTTTCTGGGAAAAATGGTGGG + Intronic
1061674630 9:132208773-132208795 CCTTTTGGGGGTACAATTCTAGG + Intronic
1186166397 X:6831004-6831026 GCTTTTATGGGTAATTTGGTGGG + Intergenic
1188328911 X:28844204-28844226 CCTTTTTTGGGAACTTTGGTGGG - Intronic
1192629754 X:72768267-72768289 CCTTTTCTGGGTCAAATGCTGGG + Intergenic
1192651956 X:72952537-72952559 CCTTTTCTGGGTCAAATGCTGGG - Intergenic
1194120112 X:89951447-89951469 CTTTTAATGTGTAGAATGGTTGG - Intergenic
1195449888 X:104999230-104999252 CCTTCTATTGTTACAATGGATGG - Intronic
1195949750 X:110256901-110256923 ACTTTTAAGGGGACAATGTTAGG - Intronic
1198153661 X:133935503-133935525 CCTTTTGGGGGTAGAATGGATGG - Intronic
1198746146 X:139892583-139892605 CCTTTTATGGGTACAATGGTTGG - Intronic
1199001647 X:142645495-142645517 CCTTTTATGCCTACAATTTTTGG + Intergenic
1200472974 Y:3608968-3608990 CTTTTAATGTGTAGAATGGTTGG - Intergenic