ID: 1198754830

View in Genome Browser
Species Human (GRCh38)
Location X:139971543-139971565
Sequence ATTCCATGCCTGGCATACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198754830_1198754838 11 Left 1198754830 X:139971543-139971565 CCACCGTATGCCAGGCATGGAAT No data
Right 1198754838 X:139971577-139971599 TCCCTTGGGTGGAGGCCAGCTGG No data
1198754830_1198754834 -4 Left 1198754830 X:139971543-139971565 CCACCGTATGCCAGGCATGGAAT No data
Right 1198754834 X:139971562-139971584 GAATTCTCGCGGCAATCCCTTGG No data
1198754830_1198754836 0 Left 1198754830 X:139971543-139971565 CCACCGTATGCCAGGCATGGAAT No data
Right 1198754836 X:139971566-139971588 TCTCGCGGCAATCCCTTGGGTGG No data
1198754830_1198754837 3 Left 1198754830 X:139971543-139971565 CCACCGTATGCCAGGCATGGAAT No data
Right 1198754837 X:139971569-139971591 CGCGGCAATCCCTTGGGTGGAGG No data
1198754830_1198754842 16 Left 1198754830 X:139971543-139971565 CCACCGTATGCCAGGCATGGAAT No data
Right 1198754842 X:139971582-139971604 TGGGTGGAGGCCAGCTGGGTAGG No data
1198754830_1198754840 12 Left 1198754830 X:139971543-139971565 CCACCGTATGCCAGGCATGGAAT No data
Right 1198754840 X:139971578-139971600 CCCTTGGGTGGAGGCCAGCTGGG No data
1198754830_1198754835 -3 Left 1198754830 X:139971543-139971565 CCACCGTATGCCAGGCATGGAAT No data
Right 1198754835 X:139971563-139971585 AATTCTCGCGGCAATCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198754830 Original CRISPR ATTCCATGCCTGGCATACGG TGG (reversed) Intergenic
No off target data available for this crispr