ID: 1198755937

View in Genome Browser
Species Human (GRCh38)
Location X:139982601-139982623
Sequence ACATATATACAAAAATTAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152764
Summary {0: 6, 1: 91, 2: 1888, 3: 15560, 4: 135219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198755937_1198755938 2 Left 1198755937 X:139982601-139982623 CCGGCTAATTTTTGTATATATGT 0: 6
1: 91
2: 1888
3: 15560
4: 135219
Right 1198755938 X:139982626-139982648 GTATTTTTTTTAGTAGAGATAGG 0: 461
1: 1664
2: 4002
3: 18637
4: 146675
1198755937_1198755941 22 Left 1198755937 X:139982601-139982623 CCGGCTAATTTTTGTATATATGT 0: 6
1: 91
2: 1888
3: 15560
4: 135219
Right 1198755941 X:139982646-139982668 AGGGTTTCACCATGTTGGCCAGG 0: 29630
1: 119747
2: 180457
3: 189702
4: 141729
1198755937_1198755940 17 Left 1198755937 X:139982601-139982623 CCGGCTAATTTTTGTATATATGT 0: 6
1: 91
2: 1888
3: 15560
4: 135219
Right 1198755940 X:139982641-139982663 GAGATAGGGTTTCACCATGTTGG 0: 2221
1: 75800
2: 144489
3: 131467
4: 75720
1198755937_1198755942 26 Left 1198755937 X:139982601-139982623 CCGGCTAATTTTTGTATATATGT 0: 6
1: 91
2: 1888
3: 15560
4: 135219
Right 1198755942 X:139982650-139982672 TTTCACCATGTTGGCCAGGCTGG 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
1198755937_1198755939 3 Left 1198755937 X:139982601-139982623 CCGGCTAATTTTTGTATATATGT 0: 6
1: 91
2: 1888
3: 15560
4: 135219
Right 1198755939 X:139982627-139982649 TATTTTTTTTAGTAGAGATAGGG 0: 21
1: 1039
2: 6383
3: 32409
4: 228543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198755937 Original CRISPR ACATATATACAAAAATTAGC CGG (reversed) Intergenic
Too many off-targets to display for this crispr