ID: 1198757902

View in Genome Browser
Species Human (GRCh38)
Location X:140000497-140000519
Sequence CAATCTGACTGAGGGGCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198757898_1198757902 13 Left 1198757898 X:140000461-140000483 CCAGTATTTTATTGAGGATTTTT 0: 8281
1: 5080
2: 2467
3: 1132
4: 1140
Right 1198757902 X:140000497-140000519 CAATCTGACTGAGGGGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198757902 Original CRISPR CAATCTGACTGAGGGGCATA AGG Intergenic
No off target data available for this crispr