ID: 1198757902 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:140000497-140000519 |
| Sequence | CAATCTGACTGAGGGGCATA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1198757898_1198757902 | 13 | Left | 1198757898 | X:140000461-140000483 | CCAGTATTTTATTGAGGATTTTT | 0: 8281 1: 5080 2: 2467 3: 1132 4: 1140 |
||
| Right | 1198757902 | X:140000497-140000519 | CAATCTGACTGAGGGGCATAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1198757902 | Original CRISPR | CAATCTGACTGAGGGGCATA AGG | Intergenic | ||
| No off target data available for this crispr | |||||