ID: 1198761238

View in Genome Browser
Species Human (GRCh38)
Location X:140034719-140034741
Sequence AGGGAAAAACAGAAGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198761230_1198761238 23 Left 1198761230 X:140034673-140034695 CCTGCCATGAGACATTGTGGCCA No data
Right 1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG No data
1198761229_1198761238 24 Left 1198761229 X:140034672-140034694 CCCTGCCATGAGACATTGTGGCC No data
Right 1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG No data
1198761231_1198761238 19 Left 1198761231 X:140034677-140034699 CCATGAGACATTGTGGCCAGCAA No data
Right 1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG No data
1198761233_1198761238 3 Left 1198761233 X:140034693-140034715 CCAGCAAGGCAGACTGAATAAAT No data
Right 1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198761238 Original CRISPR AGGGAAAAACAGAAGAGGGA AGG Intergenic
No off target data available for this crispr