ID: 1198761561

View in Genome Browser
Species Human (GRCh38)
Location X:140038345-140038367
Sequence AGGGAGAGGAAAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198761546_1198761561 25 Left 1198761546 X:140038297-140038319 CCCCCATTCCCCAGTAGCACACA No data
Right 1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG No data
1198761550_1198761561 17 Left 1198761550 X:140038305-140038327 CCCCAGTAGCACACAGAAAGAGA No data
Right 1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG No data
1198761551_1198761561 16 Left 1198761551 X:140038306-140038328 CCCAGTAGCACACAGAAAGAGAA No data
Right 1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG No data
1198761552_1198761561 15 Left 1198761552 X:140038307-140038329 CCAGTAGCACACAGAAAGAGAAT No data
Right 1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG No data
1198761549_1198761561 22 Left 1198761549 X:140038300-140038322 CCATTCCCCAGTAGCACACAGAA No data
Right 1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG No data
1198761545_1198761561 28 Left 1198761545 X:140038294-140038316 CCTCCCCCATTCCCCAGTAGCAC No data
Right 1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG No data
1198761543_1198761561 30 Left 1198761543 X:140038292-140038314 CCCCTCCCCCATTCCCCAGTAGC No data
Right 1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG No data
1198761544_1198761561 29 Left 1198761544 X:140038293-140038315 CCCTCCCCCATTCCCCAGTAGCA No data
Right 1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG No data
1198761547_1198761561 24 Left 1198761547 X:140038298-140038320 CCCCATTCCCCAGTAGCACACAG No data
Right 1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG No data
1198761548_1198761561 23 Left 1198761548 X:140038299-140038321 CCCATTCCCCAGTAGCACACAGA No data
Right 1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198761561 Original CRISPR AGGGAGAGGAAAGTGACTGT GGG Intergenic
No off target data available for this crispr