ID: 1198767210

View in Genome Browser
Species Human (GRCh38)
Location X:140091743-140091765
Sequence ATGGAGGAGCAGCAGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1438
Summary {0: 1, 1: 0, 2: 10, 3: 162, 4: 1265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198767207_1198767210 -10 Left 1198767207 X:140091730-140091752 CCTGAAGAGGAGGATGGAGGAGC 0: 1
1: 0
2: 2
3: 46
4: 409
Right 1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG 0: 1
1: 0
2: 10
3: 162
4: 1265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198767210 Original CRISPR ATGGAGGAGCAGCAGAAGGA GGG Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900831233 1:4967161-4967183 CTGGAGGAGCAGCAGAGGCCGGG - Intergenic
900864254 1:5255899-5255921 AGGGAGGAGCAGAGGATGGAGGG + Intergenic
900908477 1:5577407-5577429 GTGCAGGAGCAGTAGAAGGGAGG - Intergenic
901078979 1:6572953-6572975 AAGGAGGAGCAGCAGTGGGCAGG - Intronic
901241075 1:7693821-7693843 CTGGAGGAGCTGGAGAGGGAGGG - Intronic
901604721 1:10450175-10450197 AAGGAAGAGCAGCAGCAGGGTGG + Exonic
901881355 1:12195688-12195710 ATGGAGGAGGAGGACAAGGGAGG + Intronic
902005038 1:13225538-13225560 ATGGAGAAGAGACAGAAGGAGGG - Intergenic
902024264 1:13371332-13371354 ATGGAGAAGAGACAGAAGGAGGG - Intronic
902159142 1:14515546-14515568 ATGGTAGAACAGGAGAAGGATGG - Intergenic
902260707 1:15222779-15222801 AGGGAGGAGAAGGAAAAGGAAGG + Intergenic
902472163 1:16656731-16656753 CTGGAGGAGGAGCAGCAGGGAGG - Intergenic
902486640 1:16750715-16750737 CTGGAGGAGGAGCAGCAGGGAGG + Intronic
902572616 1:17356402-17356424 TTCCAGGAGCAGCAGAATGAGGG + Exonic
902654826 1:17859961-17859983 AGGGAGGAGCAGGTGGAGGAAGG + Intergenic
902675611 1:18006556-18006578 AGGGGGGAACAGAAGAAGGAAGG + Intergenic
902726686 1:18340884-18340906 AAGGAGAAGAAGCAGAAGCAGGG - Intronic
902767160 1:18625016-18625038 ATGCAGGAGGAGCATACGGATGG - Intergenic
903187450 1:21636849-21636871 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
903224104 1:21885196-21885218 AGGAAGGAGGAGCGGAAGGAGGG + Intronic
903450843 1:23452704-23452726 ATGAAGGGGCAGCTGAGGGACGG - Exonic
903575795 1:24339019-24339041 ATGAAGCAGCAGCAGCAGTATGG - Intronic
903959213 1:27046213-27046235 AAGGAGGAGAAGAAGAAGGTGGG - Intergenic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904187099 1:28714087-28714109 TTGGAGGAGCAGAAGAAGCAAGG + Exonic
904286029 1:29453801-29453823 GAGGAGGAGGAGGAGAAGGAGGG - Intergenic
904353167 1:29922076-29922098 ATGGAGGCAGTGCAGAAGGATGG - Intergenic
904358825 1:29959488-29959510 AAGGAGGACCAGCAGCAGGCAGG + Intergenic
904955854 1:34283378-34283400 AAGCAGGAGCAGCAGAGGAAGGG - Intergenic
905393199 1:37651154-37651176 ATTGTGGAGCAGCAGGTGGAAGG - Intergenic
905529088 1:38662177-38662199 ATGAAGGAGAAAAAGAAGGAAGG + Intergenic
905589132 1:39147028-39147050 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
905898305 1:41563427-41563449 AGGGAGGAGGGGAAGAAGGAGGG - Intronic
905951669 1:41956819-41956841 ATGGAGGAGAAGGAGTTGGAAGG + Intronic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906180846 1:43817594-43817616 AAGGAGGAGAAGGAGAAGGGAGG - Intronic
906180866 1:43817681-43817703 AAGAAGGAGAAGAAGAAGGAAGG - Intronic
906477933 1:46182333-46182355 ATGGAGAAGGAGCAGTGGGAGGG + Intronic
906516736 1:46443417-46443439 AAGAAGGAGAAGGAGAAGGAGGG - Intergenic
906559150 1:46742223-46742245 ATTGTGGAGGAGCAGGAGGATGG + Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906636825 1:47415866-47415888 ATGGAAGGCCAGGAGAAGGATGG + Intergenic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
906924690 1:50102454-50102476 AGGGAGGAGGAGGAGAAAGAAGG - Intronic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
908059238 1:60329086-60329108 AAGGAGGAAGAGGAGAAGGAAGG - Intergenic
908141225 1:61187370-61187392 TTGGAGAAGCAGCTGAGGGATGG - Intronic
908554558 1:65244884-65244906 ATATAGAAGGAGCAGAAGGAGGG + Intergenic
908592787 1:65651823-65651845 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
908598362 1:65711828-65711850 ATGGAGGGCAAGCAGAAGCAAGG - Intergenic
908706775 1:66965838-66965860 ATGGAGATACAGCAGAAGGATGG - Intronic
909172120 1:72310452-72310474 AAGGAGAAGGAGCAGAATGAGGG - Intergenic
909536501 1:76741941-76741963 ATGGAGGGGAAGCTGAAGCAGGG - Intergenic
909562980 1:77025781-77025803 CTGGAGGAGGGGCAGCAGGAGGG - Intronic
909660002 1:78071515-78071537 AAGGAGGAGGAGGAGAAAGAAGG - Intronic
910017554 1:82546347-82546369 AATGAGGAGCATCAGAAAGAGGG + Intergenic
910206303 1:84752224-84752246 AAGAAGGAGAAGGAGAAGGAGGG - Intergenic
910283980 1:85532666-85532688 ATGGTGGAGCAGCATATGAAGGG + Intronic
910330917 1:86071852-86071874 ATGGAGGGCAAGCAGAAGCAGGG + Intronic
910364216 1:86446745-86446767 AAGGAGCAGCAGCAGAAGTCAGG + Intronic
910547981 1:88440794-88440816 AAGGAGGAGAAGGAGAAAGAAGG + Intergenic
910760713 1:90728792-90728814 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
911474312 1:98357485-98357507 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
911636204 1:100238450-100238472 GAGGAGGAGAAGGAGAAGGAAGG - Intronic
911644776 1:100326550-100326572 AGGAAGGAGAAGAAGAAGGAAGG - Intergenic
911938540 1:104011768-104011790 ATGGAGGGCGAGCAGAAGCAGGG - Intergenic
912216537 1:107619913-107619935 TTGGAGGAGGAACAGAATGAAGG - Intronic
912319573 1:108699357-108699379 ACGCAGGCGCAGCAGAAGTAGGG + Exonic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
912675713 1:111679232-111679254 ATGGAGGGCTAGCAGAAGCAGGG + Intronic
912933677 1:113985019-113985041 CTGGAGGAGGAGGAAAAGGAGGG - Intergenic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913102816 1:115584822-115584844 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
914206038 1:145530319-145530341 ATGGTGGAGCAGCATATGAAGGG - Intergenic
914357827 1:146902967-146902989 ATAGAGGAAAAGCAGGAGGAAGG - Intergenic
914918314 1:151831553-151831575 CTGGAGGAGAAACAGGAGGAGGG - Intronic
914923727 1:151865375-151865397 AGGGAGTTGCAGCAGGAGGAAGG - Intergenic
914964655 1:152244181-152244203 ATGGAGAAGAAGGAGAAGGGAGG - Intergenic
915047182 1:153028005-153028027 AGGAAGGAGAAGGAGAAGGAGGG - Intergenic
915061444 1:153188950-153188972 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
915121125 1:153630028-153630050 AGGGGTGGGCAGCAGAAGGAAGG + Intronic
915191870 1:154157604-154157626 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
915712174 1:157910661-157910683 ATGCAAGAGCAGCAGAGGCATGG + Intergenic
915791614 1:158678136-158678158 ATGGAAGCGCTGCAGACGGAAGG - Intronic
916143781 1:161722639-161722661 CTGCAGCAGCTGCAGAAGGATGG - Exonic
916323341 1:163530419-163530441 ATGGAGAAGAAGGGGAAGGAAGG - Intergenic
916332076 1:163628341-163628363 ATGGAGGGGGAGGAGGAGGAGGG - Intergenic
916585899 1:166149914-166149936 AGGAAGGACCAGCAGAGGGAAGG - Intronic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
916657073 1:166885787-166885809 AAGGAGGAGGAGGGGAAGGAGGG - Intergenic
916714609 1:167438682-167438704 ACGGAGGAACCTCAGAAGGATGG + Intronic
916881586 1:169024321-169024343 AGAGAGGAGGAGGAGAAGGAAGG + Intergenic
916922713 1:169485800-169485822 TTGGCGGAGGAGGAGAAGGAAGG - Exonic
917019292 1:170569016-170569038 ATGGAGGGCGAGCAGAAGCAGGG + Intergenic
917779032 1:178371563-178371585 ATGGAGGAGGAGGAGAAGAAAGG + Intronic
917815543 1:178706202-178706224 GTGGAGGAGCAGTAGGAGAATGG + Intergenic
917880648 1:179332544-179332566 AGGGAGAAGCGGCAGAAGGGAGG - Intronic
918163277 1:181920577-181920599 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
918301497 1:183208136-183208158 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
918378880 1:183935259-183935281 ATGGAGGAGCAACATAAAGCAGG - Intronic
918725575 1:187917612-187917634 TAGGAGGAGGAGCAGAAGGATGG - Intergenic
918859139 1:189799016-189799038 ATGGAAGAGCAGCAGCAAGATGG + Intergenic
919145886 1:193634371-193634393 AGGGAAGAGGAGAAGAAGGAAGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919449341 1:197751886-197751908 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
919718253 1:200803035-200803057 ATCTAAGAGCAGCAGCAGGAAGG - Intronic
919813188 1:201421810-201421832 AGGGAGGAGGGGCAGCAGGAGGG - Intronic
919892217 1:201983359-201983381 AGGGAGGAGACGCGGAAGGACGG - Intronic
919929518 1:202212288-202212310 ATGGAGGGCGAGCAGAGGGAAGG + Intronic
920922226 1:210307524-210307546 ATGGAGTAGAAACAGAAGGGAGG - Intergenic
921361009 1:214331136-214331158 AAGAGGGAGCAGGAGAAGGATGG + Intronic
921707976 1:218345803-218345825 AAGGAGGAGCAGGAGAAGGAGGG + Intergenic
921887521 1:220321621-220321643 ATGGAGGAGGAAGAGGAGGAAGG + Intergenic
922066128 1:222145639-222145661 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
922619506 1:226981321-226981343 ACTCAGGAGCAGCAGAAGGCCGG - Intronic
922707965 1:227800354-227800376 AAGAAGGAGAAGGAGAAGGAGGG - Intergenic
923051599 1:230394439-230394461 GGGGAGGAGCAGCACAGGGAGGG - Intronic
923135998 1:231119759-231119781 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
923286583 1:232501914-232501936 AGGGAGAAGCAGCCGAAGGAAGG - Intronic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
923658539 1:235939120-235939142 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
923712014 1:236395453-236395475 AAGGAGGAGAAGAAGAAGGGAGG + Intronic
924327309 1:242908926-242908948 GAGGAGGAGGAGGAGAAGGAGGG - Intergenic
924481172 1:244435637-244435659 ATGGAGGAGGAAGAGAAGGATGG - Intronic
924481176 1:244435656-244435678 ATGGAGGAGGAAGAGGAGGATGG - Intronic
924499813 1:244626724-244626746 GTGAAGAAGCTGCAGAAGGAAGG - Intronic
924654027 1:245956645-245956667 GAGGAGGAGAAGTAGAAGGAGGG - Intronic
924705686 1:246500074-246500096 AAGGAGCAGCAGCAGCAGCAGGG - Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063100129 10:2943006-2943028 ATGGAGGGGGAGCTGAAGGATGG + Intergenic
1063295675 10:4803247-4803269 GTGGAGGAGGAGCACCAGGAAGG + Intronic
1063330683 10:5155932-5155954 ATGGAGAAGAGGCAGAATGAAGG - Intergenic
1063500931 10:6553610-6553632 GTGGAGGAGAAGGAGGAGGAAGG - Intronic
1063850075 10:10177860-10177882 AGGAAGGAGAAGGAGAAGGAAGG - Intergenic
1063850082 10:10177902-10177924 AGGAAGGAGAAGGAGAAGGAAGG - Intergenic
1063983949 10:11481016-11481038 ATGGGAGAGGAGCAGAAGAAGGG - Intronic
1064003528 10:11682675-11682697 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1064328471 10:14372581-14372603 ATGGAGGAGCAGCGAAGGGCTGG - Intronic
1064492926 10:15878516-15878538 ATGGAGGGGGAGCTGAAGCAGGG - Intergenic
1064959731 10:20950459-20950481 AGGGAGAAGAGGCAGAAGGAAGG - Intronic
1065188249 10:23189613-23189635 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1065241346 10:23708346-23708368 ATTGAACAGCAGCAGAAGGAGGG + Intronic
1065474774 10:26122711-26122733 AAGGAGGAGAAGGAGAAGGAGGG - Intronic
1065538633 10:26739047-26739069 AAGGAAGAGAAGCAGAAGAAAGG - Intronic
1065669685 10:28102839-28102861 AGGGAGAAACAGCAGAAGCAGGG - Intronic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067285487 10:44904744-44904766 CTGGAGGAGAAGGAGAAGGATGG + Intergenic
1067382428 10:45787371-45787393 AGGGGGGAGCGGCTGAAGGAAGG - Intronic
1067538506 10:47135035-47135057 ATGGGGAAGCAGCAGAAGTGGGG + Intergenic
1067570076 10:47365163-47365185 ATGGAGGGGCAGGGGTAGGAGGG - Intergenic
1067774945 10:49156682-49156704 ATGGGGCAGCAACAGCAGGAAGG + Intronic
1067793869 10:49306952-49306974 AAGGATGAGCAGCAGAACCATGG + Intronic
1067899894 10:50228835-50228857 AGGAAGGAGAAGGAGAAGGAAGG + Intronic
1068357189 10:55923809-55923831 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
1068442200 10:57072023-57072045 ATGGTGGAGAAACAGAAAGAAGG + Intergenic
1068510055 10:57954402-57954424 GAGGAGGAGGAGAAGAAGGAGGG - Intergenic
1068690201 10:59906444-59906466 AAGGAGGAGGAGCAGCAGGGAGG + Exonic
1068758763 10:60683861-60683883 ATGCAGGAAGAACAGAAGGATGG + Intronic
1069120900 10:64567795-64567817 ATGGAGGGTGAGCAGAAGTAGGG - Intergenic
1069572574 10:69503350-69503372 ATGGAGGAGCACAAGAATGCTGG - Intronic
1069580336 10:69561584-69561606 ATGCAAGAGCAGAAGAAGGGGGG + Intergenic
1069724244 10:70567160-70567182 ATGGCAGAGCAGCAGGAGTAAGG - Exonic
1070175427 10:73965710-73965732 AAGGAGAAGAAGCACAAGGACGG + Intergenic
1070211070 10:74322774-74322796 AGGGAGGAGGAGGAGAAAGAAGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070680552 10:78446083-78446105 AAGGAGGAGAAGGAGAAGGGAGG + Intergenic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1070997734 10:80800743-80800765 ATGGATGACCAGCATAAGGAGGG - Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071683863 10:87734866-87734888 AGGGAGGAGCAGCTGAGGGTGGG - Intronic
1071718502 10:88120178-88120200 AACGAGGGGGAGCAGAAGGAGGG + Intergenic
1071838537 10:89444773-89444795 ATGGAGGGGGAGCCGAAGCAGGG + Intronic
1071899875 10:90108702-90108724 ATGGAGAAAGAGCAGAGGGATGG + Intergenic
1071981955 10:91012385-91012407 ATGGAGGAGAAGGAAAAGGCAGG + Intergenic
1072044794 10:91643984-91644006 ATGGAGGGCAAGCAGAAGCAGGG + Intergenic
1072153239 10:92700169-92700191 AGTGGGGAGCAGAAGAAGGATGG - Intergenic
1072404323 10:95136029-95136051 ATGGAGGGAGAGCAGAAGCAGGG + Intergenic
1072477650 10:95778120-95778142 ATGGAGGACGAGCTGAAGCAGGG - Intronic
1072806268 10:98425641-98425663 CTGGAGAAGAAGCTGAAGGAAGG - Exonic
1073081189 10:100861973-100861995 AAAGAGGAGAAGCAGTAGGAAGG - Intergenic
1073175547 10:101554499-101554521 GTGTGGGAGAAGCAGAAGGAAGG - Exonic
1073340926 10:102744029-102744051 GCGGAGGAGCAGGAGCAGGAGGG + Exonic
1073662645 10:105493861-105493883 ATGGAGGGAAAGAAGAAGGAAGG + Intergenic
1073736778 10:106356990-106357012 ATGGAGGAAAAGTAAAAGGAAGG - Intergenic
1073757805 10:106599382-106599404 GAGGAGGAGGAGGAGAAGGAAGG + Intronic
1073941193 10:108700372-108700394 AAGGAGGAGGAGGAGAAGGGAGG + Intergenic
1074214123 10:111367530-111367552 ATGGAGGCACAGCACAAGGCAGG + Intergenic
1074271096 10:111954286-111954308 ATGGAAGAGCATCTGAAGAAAGG - Intergenic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074924453 10:118053196-118053218 AAGGAGGAGAAGGAGAAGAAGGG - Intergenic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075600595 10:123765793-123765815 CTGGAGGAGGAGCAGCAGGGTGG - Intronic
1076609321 10:131711318-131711340 AGGGAGGAGGAGCGGGAGGAGGG - Intergenic
1076809429 10:132878940-132878962 TAGGAGGAGCAGGACAAGGAGGG + Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1076996133 11:298388-298410 ATGGAGGCCCCACAGAAGGAGGG + Exonic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077222094 11:1422310-1422332 GTGGAGGAGCGGCTGGAGGAGGG - Intronic
1077280433 11:1742538-1742560 CTAGGGGAGCAGCAGGAGGAAGG + Intronic
1077387099 11:2275197-2275219 TTTGAGGAGCTGCAGGAGGATGG - Intergenic
1077477826 11:2798897-2798919 CTGGAGGAGCAGGAACAGGACGG + Intronic
1077538213 11:3134516-3134538 AGGGACCAGCAGCAGGAGGAGGG - Intronic
1078264951 11:9748333-9748355 ATGCAGGAACAGCAGACGTAGGG + Intronic
1078392988 11:10952558-10952580 ATGGAGGGTCAGCCGAAGCAGGG - Intergenic
1078766187 11:14300771-14300793 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
1079777962 11:24558114-24558136 ATCCAAGAGCAGGAGAAGGATGG - Intronic
1079810950 11:24999372-24999394 AAGGAGGAGGAGCAGGAAGATGG + Intronic
1079867820 11:25758134-25758156 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
1080304055 11:30817806-30817828 ATGAGTGAGAAGCAGAAGGAAGG + Intergenic
1080417991 11:32087520-32087542 ATGGTGGAGAAGCAGGAGGGAGG + Intronic
1080757536 11:35216495-35216517 ATGGAGGAGCACTAGGAGGTAGG + Intronic
1080895766 11:36447833-36447855 ATGGAAGAGATGGAGAAGGAGGG + Intronic
1080965704 11:37211413-37211435 ATGGAGGGCGAGCAGAAGCAGGG - Intergenic
1081016551 11:37888956-37888978 AGGGTGGAGAAGCAGATGGAAGG - Intergenic
1081118197 11:39231914-39231936 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
1081581933 11:44358534-44358556 ATGAAGGAGAAGGAAAAGGATGG - Intergenic
1081960309 11:47131189-47131211 ATGGAGGAGTGCCAGATGGAAGG - Intronic
1082762098 11:57136929-57136951 AAGGAGGAGGAGGAAAAGGAAGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083337382 11:61931637-61931659 GAGGAGGAGGAGGAGAAGGAAGG + Intergenic
1083431112 11:62613890-62613912 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1083622528 11:64056218-64056240 CTGGAGGAGCTGCAGCAGGTGGG + Intronic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084465690 11:69321622-69321644 ATGAGGGTGCAGCAGATGGAAGG + Intronic
1084617251 11:70244791-70244813 ATGGAGGAGGAGGAGAGGGAAGG + Intergenic
1084717292 11:70882162-70882184 ATGGAGGAGGAGGAGGAGGGAGG + Intronic
1085475381 11:76785579-76785601 ATGGTGGACCAGCAGACGCAAGG + Intronic
1085705983 11:78787088-78787110 GGGGAGGAGCAGAAGAAGGGAGG + Intronic
1086188814 11:84053261-84053283 TTGGAGGGGAAGCAGGAGGAAGG + Intronic
1086308110 11:85503935-85503957 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1086316666 11:85602106-85602128 TTGGAGGAGAAGCAGACTGAGGG - Intronic
1087306485 11:96495482-96495504 AAGGAGGAGGAGGAGAAGGAGGG - Intronic
1088011896 11:105013790-105013812 ATGGAGGAGCAAATGAAGGATGG - Intronic
1088556667 11:111068698-111068720 AAGGAGGAGAAACAGAGGGATGG + Intergenic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088919662 11:114251750-114251772 GAGGAGGAGGAGCAGAAGGAGGG + Intergenic
1089256191 11:117195540-117195562 AGGGAAGAGAATCAGAAGGAAGG + Intronic
1089436983 11:118477214-118477236 ATGAAGGAGCAGGGGAAGGAAGG + Intronic
1089490782 11:118882521-118882543 ATGGAGGAGAGGGTGAAGGAGGG + Intergenic
1089629101 11:119772733-119772755 ATGGGGTGGCAGCAGGAGGAGGG + Intergenic
1089964904 11:122647876-122647898 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1089965884 11:122655060-122655082 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1089968021 11:122669949-122669971 TTTGATGAACAGCAGAAGGAAGG + Intronic
1090084966 11:123642678-123642700 ATAGAGGAGCAGAAGAGGGTAGG + Intronic
1090318339 11:125817799-125817821 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
1090569525 11:128031154-128031176 GAGGAGGAGGAGGAGAAGGAAGG + Intergenic
1090725173 11:129518397-129518419 ATGGAGGGCAAGCAGAAGCAAGG - Intergenic
1091090117 11:132763112-132763134 ATGGAGGGTGAGCAGAAGCAGGG - Intronic
1091166598 11:133481826-133481848 ATGGAGGAGTACAGGAAGGAGGG + Intronic
1091779269 12:3203821-3203843 GTGGAGGAGCAGGTGCAGGAGGG + Intronic
1091813793 12:3421091-3421113 ATGGAGGAGGAGGAGTGGGAGGG - Intronic
1091903483 12:4164611-4164633 GAGGAGGAGCAGGAGAAGGCGGG - Intergenic
1091933692 12:4417667-4417689 CGGGAGGAGGAGCAGCAGGAGGG - Intergenic
1092111454 12:5967708-5967730 CAGGAGGAGCAGCAGAGCGATGG - Intronic
1092199375 12:6570560-6570582 ATGGAAGATGGGCAGAAGGAAGG + Exonic
1092361387 12:7839614-7839636 ATGGAGAAGATGCTGAAGGAGGG + Intronic
1092375831 12:7954878-7954900 ATGGAGAAGATGCTGAAGGAGGG + Intergenic
1092503795 12:9074272-9074294 GTGGAGCACCAGCAGAATGAAGG - Intronic
1092637480 12:10467198-10467220 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
1092690823 12:11108510-11108532 ACGGAGGATGAGCCGAAGGAGGG + Intronic
1092703170 12:11256187-11256209 ATGGAGGACAAGCAGAAGCAAGG + Intergenic
1092910939 12:13144480-13144502 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1093242511 12:16695573-16695595 AGGGAGGAGGAGGAGAAGGAAGG + Intergenic
1093293004 12:17352233-17352255 ATAGGTGAGCAACAGAAGGAAGG - Intergenic
1093561971 12:20552511-20552533 GAGGAGGAGGAGCAGCAGGAGGG + Intronic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1093597729 12:20981705-20981727 ATGGAGGGCCAGCTGAAGCAGGG - Intergenic
1093775328 12:23067138-23067160 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1094387266 12:29908895-29908917 AAGGAGGAACAGAAGAAGGGAGG - Intergenic
1094680382 12:32662031-32662053 AGGGAGGAGGAGCAGGACGATGG - Intergenic
1094704805 12:32904281-32904303 AGGGAGGAAGGGCAGAAGGAAGG - Intergenic
1095230580 12:39734206-39734228 ATGGAGGGCGAGCAGAAGCAGGG - Intronic
1095356333 12:41280056-41280078 ATGGAGGGCGAGCAGAAGCAGGG + Intronic
1095651776 12:44619647-44619669 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1095831546 12:46591967-46591989 ATGGAGGGCTAGCAGAAGCAGGG - Intergenic
1095853035 12:46831397-46831419 AGGGAGGAGGGGCAGAAGGCGGG - Intronic
1095920700 12:47526873-47526895 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
1096156960 12:49346303-49346325 ATGGAGGAACAAGCGAAGGAAGG - Intergenic
1096263514 12:50107055-50107077 TAGGAGGAGCTGCAGAAGCAAGG + Intronic
1096514033 12:52146654-52146676 ATGGAGTATCAGCTGAAGCAGGG + Intergenic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1096886155 12:54721334-54721356 GAGGAGGAGTGGCAGAAGGAGGG - Intergenic
1097046224 12:56189439-56189461 ATGGCGGTGCGGAAGAAGGACGG - Exonic
1097098755 12:56571252-56571274 ATGGAGGAAGAGCAGGAGGAGGG - Intronic
1097229193 12:57498813-57498835 CTGAAGGAGCAGCTGAGGGAGGG + Intronic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097613603 12:61857762-61857784 GAGGAGGTGCAGGAGAAGGAGGG - Intronic
1097775780 12:63643636-63643658 TTGGTTCAGCAGCAGAAGGATGG + Intronic
1097948885 12:65403903-65403925 ATGGAGGGGGAGCCGAAGCAGGG - Intronic
1097973379 12:65659208-65659230 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1098251900 12:68579035-68579057 AAGCAGGAGAAACAGAAGGAGGG - Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098630174 12:72713341-72713363 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
1099064905 12:77963885-77963907 AGGAAGGAGAAGGAGAAGGAAGG - Intronic
1099064908 12:77963901-77963923 AGGAAGGAGAAGGAGAAGGAAGG - Intronic
1099533166 12:83812483-83812505 AAGGAGCAAAAGCAGAAGGAAGG - Intergenic
1100201240 12:92299896-92299918 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1100768823 12:97898600-97898622 ATGGAGGGCAAGCAGAAGCAGGG - Intergenic
1101022247 12:100565141-100565163 TGGCAGGAGCAACAGAAGGAAGG + Intergenic
1101472765 12:105013819-105013841 ATGGATGGGGAGCAGAAGAAGGG - Intronic
1101654417 12:106707486-106707508 GGGGAGGAGCAGCAGAAGGAGGG + Intronic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101803004 12:108038864-108038886 AATGAGGAGCAGCAGAGAGAAGG - Intergenic
1101917503 12:108907261-108907283 AAGGAAGAGGAGGAGAAGGAAGG - Intergenic
1102408760 12:112698807-112698829 AAGTAGGAGAAGGAGAAGGAGGG - Intronic
1102408801 12:112698921-112698943 AAGGAGGAGGAGGAGAAGGGCGG - Intronic
1102547644 12:113668123-113668145 CTGGAGGAGGAGGTGAAGGAGGG - Intergenic
1103172543 12:118833965-118833987 ATGGAGGAGGAAGGGAAGGAGGG + Intergenic
1103245755 12:119455824-119455846 AGGAAGGAGAAGAAGAAGGAAGG + Intronic
1103410857 12:120710544-120710566 AAGGAGGAGAAGAAGAAGGCGGG + Exonic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103932383 12:124457588-124457610 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1103946919 12:124532027-124532049 AGGGTGCAGCAGCAGAGGGAGGG - Intronic
1103954638 12:124569184-124569206 AAGCTGGAGCCGCAGAAGGAAGG + Intergenic
1104005590 12:124890044-124890066 ATGGTGGAGCAGCAGGAGGTGGG - Intergenic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104250738 12:127091057-127091079 ATGGAGCAGCACCACTAGGATGG + Intergenic
1104467649 12:129003835-129003857 TTGGAGGAACAGGAGAAGAAGGG + Intergenic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1105544856 13:21343963-21343985 AGGGAGGAGATGGAGAAGGAGGG - Intergenic
1105828345 13:24142705-24142727 AAGGAGGAGAAGAAGAAGGGAGG - Intronic
1105991142 13:25622369-25622391 AATGATGAGGAGCAGAAGGAAGG + Intronic
1106356995 13:28992392-28992414 AGGGAGGAGGAGGTGAAGGAGGG + Intronic
1106429338 13:29665426-29665448 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
1106492158 13:30236061-30236083 AAGGAGGAGAAGGAAAAGGAGGG + Intronic
1106926098 13:34614787-34614809 AAGGTGGGGCAGAAGAAGGAAGG - Intergenic
1107043532 13:35973118-35973140 AGGGAGGAGAGGCAGAAGGAGGG + Intronic
1107084230 13:36408187-36408209 AAGGAGGAGAAGGAGAAGGAGGG + Intergenic
1107449450 13:40495452-40495474 GAGGAGGAGCAGGATAAGGATGG - Intergenic
1107552703 13:41492318-41492340 AATGAGGAGCAGTAGAAGGGCGG + Intergenic
1107969430 13:45627123-45627145 ATGAAGGAGCAACAGAAGGCAGG - Intergenic
1108006108 13:45948312-45948334 ATGAAGAAGCAGCAGCAAGAGGG - Intergenic
1108095232 13:46894173-46894195 CTGGAGGAGCAGCCTAGGGAGGG + Intronic
1108277671 13:48827456-48827478 ATGGTGGAGCAGGAGAGAGAGGG + Intergenic
1108596145 13:51951342-51951364 ATGGAGAAGCAGCTAAGGGAGGG + Intronic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1108718955 13:53110496-53110518 AGGGAGGAGCAGCTGAAGACAGG - Intergenic
1108744964 13:53384028-53384050 AAGGAGGAGGAGGAGAAAGATGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1110824597 13:79957952-79957974 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
1110842705 13:80161064-80161086 AGGGAAGAGGAGCAGAAGGAAGG + Intergenic
1111086369 13:83380539-83380561 AGGGAGGGGGAGGAGAAGGAAGG - Intergenic
1111798434 13:92953587-92953609 ATGGTGCAGCAGCAGACGGAAGG + Intergenic
1111932583 13:94526789-94526811 ATGGAGGGGGAGCTGAAGCAGGG + Intergenic
1112072919 13:95874682-95874704 AAGAAGGAGGAGGAGAAGGAAGG - Intronic
1112490511 13:99859090-99859112 AAGGAGGAGTAGCAGGAAGAAGG + Intronic
1112620233 13:101047223-101047245 ATGGAGGGGGAACAGAAGCAGGG - Intergenic
1112637044 13:101226912-101226934 AGGGAGGGGAAGCATAAGGAAGG - Intronic
1113136931 13:107101176-107101198 ATGGAGGAGGGGAAGAAAGATGG - Intergenic
1113556594 13:111240534-111240556 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1113843238 13:113371783-113371805 ATGGAGGGGCCTCAGGAGGAGGG - Intergenic
1114626433 14:24132955-24132977 ATGGAGGTCAAGCATAAGGAAGG - Intergenic
1115018535 14:28646398-28646420 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1115095235 14:29627364-29627386 CTGGAGAGGCTGCAGAAGGATGG + Intronic
1116010621 14:39347407-39347429 AGGGAGGAGGAAAAGAAGGAAGG + Intronic
1116233925 14:42253634-42253656 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1116255846 14:42554274-42554296 AGGAAGGAGGAGAAGAAGGAAGG + Intergenic
1116401814 14:44516137-44516159 ATGGAGGGTCAGCTGAAGCAGGG - Intergenic
1116524776 14:45891124-45891146 ATGGAGGAGCAGGAGAGAGAGGG - Intergenic
1116658225 14:47675992-47676014 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1117047845 14:51830504-51830526 ATGCAGGAGAAGCAGATTGAAGG - Intronic
1117120975 14:52568146-52568168 ATGGAGGGTGAGCAGAAGCAGGG + Intronic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117581482 14:57155909-57155931 ATGGAGGAGCAGGAGGGGAAAGG + Intergenic
1117761636 14:59035328-59035350 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118459552 14:65976033-65976055 GAGGAGGAGGAGAAGAAGGAGGG + Intronic
1118766768 14:68915264-68915286 GAGGAGGAGGAGGAGAAGGAGGG - Intronic
1119024922 14:71144925-71144947 ATGGAAGAGCTGCATAGGGAGGG - Intergenic
1119071869 14:71594057-71594079 ATGGAGGAGGAGGAGAAGGAAGG - Intronic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119265152 14:73259978-73260000 AAGGAGGAGGGGCAGAGGGAGGG - Intronic
1119379523 14:74219604-74219626 AATGAGGAGCAGCAGAAGGTGGG - Intergenic
1119409978 14:74424578-74424600 ATGGAAGAGGAGAAGAAGGGAGG + Intronic
1119634443 14:76262642-76262664 AAAGAGGAGCAGCAGAAAGATGG + Intergenic
1120034517 14:79681235-79681257 ATGAAGGCTCAGCAGGAGGAGGG - Intronic
1120068475 14:80074672-80074694 ATGGAAGAGAAGCAGAGTGAAGG - Intergenic
1120578650 14:86217756-86217778 ATGGAGGAGGAGGAGGAAGAAGG - Intergenic
1120787167 14:88548488-88548510 AGGGAGGTGCAGCAAAGGGAAGG - Intronic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1120964453 14:90155272-90155294 ATGGAGGAGGAGCAGCAAGGAGG + Intronic
1121249327 14:92488042-92488064 GAGGAGGAGGAGGAGAAGGATGG - Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121734944 14:96211666-96211688 AAGGAGGAGCGGGAGGAGGAGGG - Intronic
1121735729 14:96216749-96216771 AAGGAGGAGGAGGAGGAGGAAGG + Intronic
1121766788 14:96494720-96494742 ATGGGGGAGCAGCAGGTAGAGGG - Intergenic
1121936038 14:98019832-98019854 CTTGAGGAGAAGCAGCAGGATGG - Intergenic
1122482336 14:102055255-102055277 ATGCAGGAGGAGCAGAGTGATGG - Intergenic
1122609792 14:102974011-102974033 AAGGAGGAGCTGCACAAGGTAGG - Exonic
1122765654 14:104067806-104067828 ATGGTGGAGCAGAAGAGAGAGGG + Intergenic
1123022665 14:105408958-105408980 GAGGAGGAGGAGCAGGAGGAGGG - Intronic
1123133990 14:106010855-106010877 CTTGGGGAGCAGCAGAAGGTGGG + Intergenic
1123991812 15:25689145-25689167 AGGAAGGAGCTGCAGAAGGCTGG - Intronic
1124593248 15:31071557-31071579 ATGGAAGGCCATCAGAAGGAGGG - Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1125158246 15:36614213-36614235 AGGGAGGAGCAGCAGCAGGGTGG - Intronic
1125301046 15:38253135-38253157 ATGGAGGAGCAACAGCAGGCGGG - Exonic
1125423498 15:39527492-39527514 AATGAGGAGCAGGAGAAAGAGGG - Intergenic
1125490807 15:40147209-40147231 AAGGAGCAGAACCAGAAGGAAGG + Intergenic
1125601134 15:40916326-40916348 AAAGAGAAGGAGCAGAAGGAGGG - Intergenic
1125772229 15:42176453-42176475 CTGGAGGAGAGGCAGAGGGATGG + Intronic
1125891958 15:43273705-43273727 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1126280922 15:46948403-46948425 ATGGAGGACCAGTAGAAAAAAGG - Intergenic
1126371925 15:47956423-47956445 AGGGAGGAAGAGCAGAGGGATGG - Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126736422 15:51736459-51736481 ATGAAGGAGCATCAGTATGAAGG - Intronic
1126787299 15:52187494-52187516 GTGGAGGAGGAATAGAAGGATGG + Intronic
1126886668 15:53158305-53158327 AAGGAGGAGAATGAGAAGGAGGG + Intergenic
1127173070 15:56323757-56323779 AAGGAGGAGAAGGAGAGGGAGGG + Intronic
1127269870 15:57390796-57390818 CTGTGGGAGGAGCAGAAGGATGG + Intronic
1127452607 15:59131471-59131493 ATGGAGGGCGAGCAGAAGTAGGG + Intergenic
1127572983 15:60262238-60262260 TTGGATGACCAGCAGAAAGAAGG - Intergenic
1128146803 15:65336523-65336545 TGGGAGGAGTAGGAGAAGGAGGG - Intronic
1128243764 15:66119025-66119047 AGGGAGGAGAGGCAAAAGGAGGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1128981340 15:72189128-72189150 AAGGAGGAGAAGGAGAAGGCAGG + Intronic
1129958348 15:79659900-79659922 ATGGAGCAGCATCAGAGAGATGG + Intergenic
1130127420 15:81105381-81105403 ATGGAGGAAGGGAAGAAGGAAGG - Intronic
1130138418 15:81200966-81200988 TTGGAGGATGAGGAGAAGGAAGG - Intronic
1130441836 15:83962859-83962881 ATGGAGGGCCAGCTGAAGCATGG + Intronic
1130721103 15:86386264-86386286 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1130723955 15:86419308-86419330 ATGGAGGGTGAGCAGAAGCAGGG + Intronic
1130825577 15:87542058-87542080 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1130927487 15:88396441-88396463 GAGGAGGAGCAGGAAAAGGAAGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131014180 15:89043625-89043647 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131139862 15:89968233-89968255 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1131269083 15:90935553-90935575 GTGGAGCAGCTGCGGAAGGAGGG + Exonic
1131351193 15:91701424-91701446 ATGAAGGAGGAGAGGAAGGAAGG + Intergenic
1131430162 15:92380888-92380910 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1131643986 15:94322244-94322266 ATGGAGGAGCAGCAGCTTTAGGG + Intronic
1131856718 15:96605178-96605200 ATGGAAGAGCAGAGGAACGAAGG + Intergenic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132267180 15:100484454-100484476 CTGCCGGAGCAGCAGAGGGAGGG - Intronic
1132307159 15:100824751-100824773 ATGAAAGAGAAGCTGAAGGATGG - Intergenic
1132726882 16:1342762-1342784 ATGGCTGAGCAGCAGCAGGTGGG - Exonic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133971598 16:10572085-10572107 ATGAGGGAGCAGGAGAAAGAGGG + Intronic
1134105585 16:11483969-11483991 ACAGAGGAGAAGCAGGAGGAAGG + Intronic
1134692157 16:16197954-16197976 AAGGAGGAGGGGGAGAAGGAGGG + Intronic
1134768269 16:16781502-16781524 AAGGAGGAGCAAGAGAAGAAGGG - Intergenic
1134867286 16:17619839-17619861 ATGGAGGGGTAAGAGAAGGAAGG - Intergenic
1134997410 16:18750660-18750682 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1135114519 16:19713563-19713585 ATGGAGGTGGAGGAGGAGGATGG + Intronic
1135175237 16:20221955-20221977 AGGCAGGAGCAGGAGAAGGGAGG - Intergenic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1135913147 16:26579214-26579236 AAGGAGGAGAAGAAGAAGGAAGG - Intergenic
1135942448 16:26834304-26834326 GAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136168233 16:28470711-28470733 GTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136294240 16:29292540-29292562 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1136309489 16:29397839-29397861 CTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136539095 16:30918701-30918723 AAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137557019 16:49477215-49477237 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1137557108 16:49477455-49477477 AAGGAGGAGGAGGAGAAAGAAGG + Intergenic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1137938221 16:52656063-52656085 AGGGAGGAGCAGCAGCAGGGTGG - Intergenic
1137981288 16:53072215-53072237 CTGCAGGAGCAGCAGCTGGAGGG - Intronic
1138112693 16:54337224-54337246 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1138395351 16:56700030-56700052 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1138486688 16:57349802-57349824 ATGGAAGAGCGAGAGAAGGAAGG - Intergenic
1138773026 16:59687513-59687535 ATGGTGGAGCAGGAGGAAGAGGG + Intergenic
1139165573 16:64561410-64561432 AAGAAGGAGGAGGAGAAGGAAGG + Intergenic
1139225189 16:65227801-65227823 AGGGAGGAGTAACAGAATGAGGG - Intergenic
1139268241 16:65659430-65659452 ATGGAGAAGGTGCAGAGGGATGG + Intergenic
1139277492 16:65741443-65741465 ATGGAGGGGGTGCAGAAGAAGGG + Intergenic
1139346278 16:66305922-66305944 ATGGTGGAGCAGGAGAGAGAGGG - Intergenic
1139946330 16:70644909-70644931 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
1139976356 16:70814325-70814347 ATAGAGGAAAAGCAGGAGGAAGG + Intronic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141334857 16:83145088-83145110 TTGGAGGAGCAGCATATGGATGG - Intronic
1141898404 16:86973660-86973682 ACAGAGAAGCAGCAGAAGGGTGG + Intergenic
1142100144 16:88266586-88266608 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1142338963 16:89508422-89508444 ACGGAGCAGCAGCAGCAGCACGG - Exonic
1142432483 16:90037456-90037478 AGGGAGGAGCATCACAGGGAGGG + Intronic
1142642480 17:1292447-1292469 CTCGAGCAGCACCAGAAGGAGGG - Intronic
1142905048 17:3035719-3035741 AGGGAGGAGGAGAACAAGGATGG + Exonic
1143021614 17:3919625-3919647 ATGGAGGAGGACCAGGAGGGTGG - Intergenic
1143046700 17:4086604-4086626 CTGGAGTAGCTGCAGAAGCAGGG + Exonic
1143331875 17:6143371-6143393 ATGGAGGAGCTAGAGATGGATGG - Intergenic
1143410849 17:6707504-6707526 AAGGAGGAGAAGGAGGAGGAGGG + Intronic
1143794718 17:9327364-9327386 AGGGAGAAGGAGGAGAAGGAGGG + Intronic
1143976207 17:10831795-10831817 ATGGAGGAGCAGGAGAAGCCTGG + Intronic
1144048110 17:11471353-11471375 AGGGAGGACCAGCAGGAGGCTGG - Intronic
1144058042 17:11558981-11559003 ATGGGGAGGCAGCTGAAGGAAGG - Exonic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1145738295 17:27249351-27249373 ATGGAGGGCCAGCCGAAGCAGGG + Intergenic
1145797192 17:27662563-27662585 AGGAGGGAGCCGCAGAAGGATGG - Intergenic
1145898246 17:28473370-28473392 CTGGAGGAGCTGGAGAAGGAAGG - Exonic
1145980400 17:29007765-29007787 AGAGGGCAGCAGCAGAAGGATGG + Intronic
1146439578 17:32882256-32882278 ATAGAGGAGGAAGAGAAGGAAGG + Intergenic
1146533113 17:33627489-33627511 TGGCAGGAGCAGCAGCAGGAGGG - Intronic
1146656298 17:34637154-34637176 CTGGAGGAGAAGGAGAAGGAGGG - Intronic
1146714047 17:35068789-35068811 ATGGAGGAGGAGGAGGAGAAAGG + Intronic
1146746420 17:35334223-35334245 ATGGAGGGCAAGCAGAAGCAGGG - Intergenic
1146953161 17:36920616-36920638 AGGGAGGAACTGGAGAAGGAAGG - Intergenic
1147119416 17:38327140-38327162 GTGGAGGAGCAGCAGAGGAAGGG - Exonic
1147341760 17:39756524-39756546 ATGGGGGAGGGGAAGAAGGAGGG + Intergenic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147566767 17:41541238-41541260 ATGGTGGGGCAGCAGAGGGAAGG - Intergenic
1147583594 17:41639826-41639848 AGGGAGGACCAGCAGAGGAAGGG + Intergenic
1147656754 17:42095490-42095512 ATGGGGCCGCAGCAGCAGGAGGG - Intergenic
1147686377 17:42288873-42288895 ATGGGGGAGCAGCCGAAGAGGGG + Intronic
1147906343 17:43825573-43825595 ATGGGGTGGCAGCAGGAGGAGGG - Intronic
1148019935 17:44547101-44547123 ATGGAGGCTCAGGAGAAGGGGGG + Intergenic
1148047677 17:44753934-44753956 CTAGAAGAGCAGCAGAAGGAAGG + Intergenic
1148403339 17:47386937-47386959 ATGGAGGGCGAGCAGAAGCAGGG - Intronic
1149281359 17:55108706-55108728 ATGGAGGGTGAGCAGAAGCAGGG - Intronic
1149304499 17:55335049-55335071 GTGGAGGAGCACCAGGAGGCAGG - Intergenic
1149594153 17:57853959-57853981 TTGAAGGAGCAGGAGAGGGACGG - Intergenic
1149618324 17:58021077-58021099 ATGAAAGTGCAGCAGAAAGATGG + Intergenic
1149646489 17:58245237-58245259 AAGGAGGAGCCCCAGAAAGAGGG - Intronic
1149657729 17:58319122-58319144 ATGGAGCAGCAGCAGGGGGGTGG + Exonic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150089440 17:62310017-62310039 GAGGAGGAGGAGCAGGAGGAAGG - Intergenic
1150105724 17:62461294-62461316 AGGGAGGAGGATCAGAAGGGAGG - Intronic
1150565181 17:66332571-66332593 GTGGAGAAGCTGCAGAGGGAGGG + Intronic
1150884542 17:69070435-69070457 ATTGAGGGGGAGCAGAAGCAGGG + Intergenic
1151038743 17:70832878-70832900 ATGCAGAAGCAGCAGTAGCAGGG + Intergenic
1151052662 17:70996068-70996090 AAGGTGGAGGAGGAGAAGGAAGG - Intergenic
1151144750 17:72030551-72030573 TGCGAGGAGCAGCGGAAGGAAGG - Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1151569537 17:74919406-74919428 ATGGAGGAGCAGGAGTTGGAAGG - Intronic
1152055582 17:78023400-78023422 GAGGAGGAGCAGGAGAAGGAAGG - Intronic
1152096209 17:78273145-78273167 ATGGGGGAACAGCAGGAGGTAGG + Intergenic
1152124550 17:78438425-78438447 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1152168651 17:78727879-78727901 AGTGAGGAGGAGCAGAAGGCAGG + Intronic
1152266282 17:79296846-79296868 AGGGAGGAGAAGCAGGAGGAGGG - Intronic
1152315955 17:79580279-79580301 AAGGAGGAGGAGGAGGAGGATGG - Intergenic
1152322378 17:79614927-79614949 AAGGAGGAGGAGGAGAAGAAAGG + Intergenic
1152340306 17:79720744-79720766 ATGGAGCAGGAGCAGGAGCAGGG - Intergenic
1152370161 17:79882677-79882699 ATTGAGGAGGAGGAGGAGGAGGG - Intergenic
1152462436 17:80448650-80448672 AGGGAGGAGGAGAAGAGGGAAGG - Intergenic
1153717934 18:7869494-7869516 ATGGAGGGAGAGCAGAAGCAGGG - Intronic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155063228 18:22247039-22247061 AGGGAGGAGGAGGAGCAGGAGGG + Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155069915 18:22305826-22305848 ATGGAAGAGCCACAGATGGAAGG + Intergenic
1155172179 18:23275167-23275189 AGGGAGGGGCAGCAGAGGGTGGG + Intronic
1155263182 18:24065091-24065113 GTGGAGGAGGAGGAGAAGCAAGG + Intronic
1155348234 18:24879764-24879786 ATGGAGGAGGAGGAGAGGAAGGG - Intergenic
1155365836 18:25048157-25048179 ATAGAGGAGCTGGAGGAGGATGG + Intergenic
1155505186 18:26526248-26526270 TTTGGGGAGCAGCAGGAGGAGGG + Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156315449 18:35965087-35965109 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1156361420 18:36387726-36387748 GTGGAGGAGCAGCAGGGAGATGG - Intronic
1156398572 18:36720692-36720714 GAGGAGGAGGAGGAGAAGGAGGG - Intronic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1157130353 18:45001591-45001613 TTTGAGGAGGAGCAGCAGGAAGG + Intronic
1157145349 18:45157006-45157028 ATGGTGGAGAAGCAGAAGAAAGG + Intergenic
1157210073 18:45734747-45734769 GAGGAGGAGGAGGAGAAGGATGG + Intronic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157584153 18:48790647-48790669 ATGGAGGAGCAGACGAAGGGAGG + Intronic
1157685562 18:49640095-49640117 AGGGAGGAGGAGGAGAATGATGG + Intergenic
1157711359 18:49851987-49852009 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1158555513 18:58471519-58471541 ATGGAGGAGGAGCAGCAGGCTGG - Intergenic
1158791745 18:60788313-60788335 ATGGTGGAAGAGCAGAAGGCAGG + Intergenic
1158812018 18:61048875-61048897 ATGGAAGAGCATAAGAAGAAAGG + Intergenic
1158882643 18:61795872-61795894 AGGGAAGAACAGAAGAAGGAAGG + Intergenic
1159734441 18:72076464-72076486 ATGGCGGAGCAGGAGAGAGAGGG + Intergenic
1159877391 18:73827645-73827667 AGGGAGGAGCAAGAGAAGGATGG + Intergenic
1159960437 18:74551410-74551432 ATGGAGGAACAGGAGAAAAATGG + Intronic
1160006002 18:75069437-75069459 GTGGAGGTGCAGCTGAAGGCGGG - Intergenic
1160159274 18:76459234-76459256 ATGGAGGAGAAGCCGAAGCTCGG - Intronic
1160254226 18:77233865-77233887 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1160361873 18:78290202-78290224 ATGGAACACCAGCAGCAGGAGGG + Intergenic
1160367306 18:78337436-78337458 AGGTAGGAGCAGCAGGAGGCCGG - Intergenic
1160845622 19:1164803-1164825 GAGGAGGAGGAGCAGGAGGAGGG + Intronic
1160965783 19:1746329-1746351 ATGGAGGAGGAGGGGGAGGAAGG + Intergenic
1161370603 19:3908843-3908865 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1161557799 19:4954413-4954435 GAGGAGGAGGAGCAGCAGGAGGG + Exonic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1161585649 19:5103994-5104016 GTGGGTGAGGAGCAGAAGGAGGG + Intronic
1161957941 19:7506664-7506686 AGGGAGGAGCTGGAGGAGGACGG - Intronic
1161958008 19:7506885-7506907 AGGGAGGAGCCAAAGAAGGAGGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162076586 19:8191965-8191987 AAGGAGGAGGAGGAGAAGGAGGG + Intronic
1162151191 19:8646797-8646819 TAGGAGGAGCAGCAGAGGAAGGG - Intergenic
1162798465 19:13098497-13098519 AAGGAGGAGGAGCAGAGGGAGGG - Intronic
1163198690 19:15746093-15746115 AAGGAGGAGGAGGAGAAGAAAGG - Intergenic
1163342065 19:16715137-16715159 AAGGAGGAAGAACAGAAGGAGGG - Intergenic
1163463092 19:17450740-17450762 AAGGAGGAGGAGGAGAAGGAAGG - Intronic
1163690897 19:18737726-18737748 GAGGAGGAGCAGCAGCAGGAGGG - Intronic
1163737697 19:18991488-18991510 TTGGAGGAGCGGCAGGAGGTGGG + Intronic
1163779662 19:19239738-19239760 AAGGAGGAGGAGTAGAAGGGAGG - Intronic
1163808965 19:19418446-19418468 ATGAAATAGCAGCAGATGGATGG + Intronic
1163818068 19:19479762-19479784 ATGGTGGAGCAGGGGAAGGAGGG - Intronic
1164047623 19:21555934-21555956 ATGGAGGGCGAGCAGAAGCAGGG - Intronic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164588640 19:29494333-29494355 ATGGAGGAAGGGAAGAAGGAAGG + Intergenic
1164612455 19:29641840-29641862 GAGGAGGAGAAGGAGAAGGAGGG + Intergenic
1164680442 19:30130871-30130893 AGGGAGGAGGAGAGGAAGGAAGG - Intergenic
1165086369 19:33350936-33350958 AGGGGTGAGCAGCTGAAGGAAGG + Intergenic
1165112559 19:33510902-33510924 AGGGAAGAGCTGCAGGAGGAAGG - Intronic
1165307997 19:35013818-35013840 ATGGAGGAACAGGACAGGGAGGG + Intronic
1165596651 19:37015217-37015239 AGTGAGGAGCATCAGAAGGTAGG - Intronic
1165847384 19:38827033-38827055 AGGGAGGAGAGGGAGAAGGAGGG + Intronic
1165905796 19:39193949-39193971 GAGGAGGAGAAGGAGAAGGAGGG - Intergenic
1166063687 19:40343679-40343701 ATGGCAGTGGAGCAGAAGGAAGG - Intronic
1166104253 19:40589688-40589710 AGGAAGGAGCAGAAGAAAGAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166626547 19:44362219-44362241 ATGGAGGAGAAGGGGGAGGAAGG + Intronic
1166700220 19:44878044-44878066 ATGGAGGAGGAGGAGGAGGGGGG - Intronic
1166882080 19:45935791-45935813 AGGGAGGAGAAACAGAATGAGGG + Exonic
1167019176 19:46861312-46861334 ATGGAGGAGCTGGAGGGGGAGGG + Intergenic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167532157 19:50024954-50024976 ATGGAGGTGCGGCCGAAGGGAGG - Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167622036 19:50566072-50566094 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1167827051 19:51983443-51983465 AGGGAGGAGCAGGAGACAGATGG - Intronic
1168000565 19:53442620-53442642 AGGAAGGAGCAGCAGCAGGGTGG - Intronic
1168005060 19:53480104-53480126 AGGAAGGAGCAGCAGCAGGGTGG - Intronic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
1168241583 19:55091645-55091667 CTGGAGGAGGAGCTGAAGGTGGG - Exonic
1168432283 19:56290972-56290994 AGAGGGGAGCAGCAGATGGAGGG - Intronic
1168530938 19:57128064-57128086 ATGGAGGGCGAGCAGAAGCAGGG - Intronic
1202704559 1_KI270713v1_random:13525-13547 CTGGAGGAGGAGCAGCAGGGAGG - Intergenic
924968581 2:101345-101367 ATGGAGGAGGAGGAAAGGGAGGG - Intergenic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
925034238 2:673732-673754 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
925299423 2:2800115-2800137 AGGTAGGAACAGCAGAAGGAGGG + Intergenic
925611318 2:5705613-5705635 GTGGAGGAGCAGGGGAAGCAGGG + Intergenic
925709623 2:6726330-6726352 ATTGAGGAGAGGCAGAAGAAAGG - Intergenic
925842592 2:8006585-8006607 AGGGAGGAGGAAAAGAAGGATGG - Intergenic
926130666 2:10301915-10301937 GTGGAGGAGGAGTGGAAGGAGGG + Intergenic
926166483 2:10524433-10524455 GTGGAGGAGCAGCAGCTGGAGGG + Intergenic
926829035 2:16940169-16940191 ATGGTGGAGCTGAAGAAAGAGGG - Intergenic
926843557 2:17108439-17108461 AGGGAGGAGAAAGAGAAGGATGG + Intergenic
926908292 2:17826251-17826273 TTGGAGGAGCAGGGAAAGGAGGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927455210 2:23242862-23242884 ATACAGGAGCAGGAGAAGGTTGG - Intergenic
927474511 2:23402140-23402162 ATCGAGGACCGGCAGGAGGAGGG + Intronic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927942382 2:27113072-27113094 AGGAAGCAGCAGCTGAAGGAGGG + Intronic
928600422 2:32898985-32899007 ATGGGGGAGAAGCAAGAGGAGGG - Intergenic
929380786 2:41350557-41350579 ATGGAGGAGAAGCAGAAGAGTGG + Intergenic
929438349 2:41946210-41946232 ATGGAGGAGCAACATGAGCAGGG + Intronic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
929666572 2:43838502-43838524 CTGGGGGAGCAGCAGCAGCAAGG + Intronic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
929789359 2:45012207-45012229 ATGGGGGAGGAGGAGAATGAGGG - Intergenic
929794079 2:45045435-45045457 AGGGAGGAGAGGAAGAAGGAAGG - Intergenic
929836549 2:45406229-45406251 ATGGAGGAGCAGTGTAGGGAAGG + Intronic
929871403 2:45762157-45762179 ATGGAAGAGAAGGAGAAGCATGG + Intronic
930176133 2:48303232-48303254 ATGGAGGGCGAGCAGAAGCAGGG - Intergenic
930362162 2:50394845-50394867 CTGGAGGAGCATGAGCAGGAAGG - Intronic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
930908960 2:56606800-56606822 ATGGAGGATGAGCTGAAGCAGGG - Intergenic
930951247 2:57146388-57146410 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
930999628 2:57764740-57764762 ATGAAGGGGCAGCATAAAGAAGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931212172 2:60207612-60207634 ATGGAGGGAGAGCAGAAGCAGGG - Intergenic
931771365 2:65500829-65500851 ACGGAGAAGCAGCAGATGAAAGG - Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
931814755 2:65889827-65889849 ATGGAGGGAGAGCAGAAGCAGGG + Intergenic
931945496 2:67301984-67302006 ATGGAGGTGCAGCAGAGGAAAGG - Intergenic
933291369 2:80442132-80442154 GTGGAGGAGAATCACAAGGATGG - Intronic
933488369 2:82950822-82950844 ATGGAGGGTGAGCAGAAGGAGGG - Intergenic
933606156 2:84386227-84386249 ATGGATAAGCTGTAGAAGGAAGG + Intergenic
933998230 2:87685637-87685659 AAAGAGGGGCAGCTGAAGGAAGG + Intergenic
934166666 2:89300163-89300185 ATGGGGAATCAGCAGAAGTACGG - Intergenic
934200615 2:89882294-89882316 ATGGGGAATCAGCAGAAGTACGG + Intergenic
934653104 2:96103550-96103572 TATGAGGAGCAGCAGCAGGAGGG - Intergenic
934792061 2:97069906-97069928 AAGGAGGGGCAGCCGAAGGAAGG + Intergenic
934792080 2:97070008-97070030 AAGGAGGGGCAGCTGAAAGAAGG - Intergenic
934814539 2:97313702-97313724 AAGGAGGGGCAGCTGAAAGAAGG + Intergenic
934814558 2:97313804-97313826 AAGGAGGGGCAGCCGAAGGAAGG - Intergenic
934823136 2:97394679-97394701 AAGGAGGGGCAGCTGAAGGAAGG + Intergenic
934823154 2:97394781-97394803 AAGGAGGGGCAGCTGAAAGAAGG - Intergenic
935009580 2:99120814-99120836 ATAAAGGGGCAGCAGAAGAATGG - Intronic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
935870028 2:107438169-107438191 ATGTTGTAGCAGCAGAAGAATGG + Intergenic
936295620 2:111265236-111265258 AAAGAGGGGCAGCTGAAGGAAGG - Intergenic
936386028 2:112030125-112030147 ATGCAGGAGCAGGAGCAAGAGGG + Intergenic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936669890 2:114644948-114644970 ATGACTGAACAGCAGAAGGAGGG - Intronic
936906006 2:117536398-117536420 AAGCAGGAGCAGCAGCAGCAAGG + Intergenic
937298879 2:120826428-120826450 ATCGAACAGCAGCAGAGGGAGGG - Intronic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937449674 2:121991978-121992000 GTGGGGGAGCAGCAGATGGAGGG - Intergenic
937465105 2:122125445-122125467 ATGGAGGATGAGCTGAAGCAGGG - Intergenic
937490257 2:122359548-122359570 AAGGAGGAGGAGTAGGAGGATGG - Intergenic
937878821 2:126849933-126849955 AAGGAGGAGGAGGAGCAGGAAGG + Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
937969413 2:127537723-127537745 AAGGAGGAGGAGGAGAAGGAAGG + Intronic
938736611 2:134191731-134191753 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
938827737 2:135023050-135023072 ATGGAGGAGCCACTGAAAGAGGG - Intronic
938928836 2:136068094-136068116 ATGGATGAGCAGCAGATAAATGG + Intergenic
938992543 2:136644062-136644084 AGGGAGGAGGAGAGGAAGGAAGG + Intergenic
939054835 2:137352160-137352182 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
939613148 2:144333098-144333120 ATCGAGGAGGTCCAGAAGGAGGG - Intergenic
939937849 2:148313938-148313960 ATGGAGGGCAAGCAGAAGCAGGG - Intronic
940032096 2:149274391-149274413 AGGGATGAGGAGGAGAAGGAAGG - Intergenic
940124773 2:150311160-150311182 ATGGAGAACTAGCAGAAGCAGGG + Intergenic
940322173 2:152389303-152389325 ATGAAGATACAGCAGAAGGATGG - Intronic
940324767 2:152413517-152413539 ATGGGGGAGGAGGAGAAGGTGGG + Intronic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
941016417 2:160362489-160362511 ATGGAGGAGAAGGAGACAGAAGG + Intronic
941293057 2:163700041-163700063 AAGAAGGAGGAGGAGAAGGAAGG + Intronic
941309472 2:163911523-163911545 GAGGAGGAGGAGGAGAAGGAAGG - Intergenic
941463288 2:165795159-165795181 TTGTTGCAGCAGCAGAAGGAAGG - Intergenic
941465190 2:165817242-165817264 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
941682421 2:168413342-168413364 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
942043625 2:172086631-172086653 CTGGAGGGACAGCAGAAGTAGGG - Intronic
942226480 2:173821232-173821254 ATCCAGGAGCGGCTGAAGGATGG - Intergenic
942612366 2:177755544-177755566 ATGGGGTCGCAGCAGAAGGAGGG - Intronic
942985412 2:182134778-182134800 GAGGAGGAGCAGCAGGATGAGGG + Intergenic
944291951 2:198018074-198018096 ATGGAGGGCGAGCAGAAGCAGGG + Intronic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945190304 2:207180760-207180782 AAGGAGGGGCAGTGGAAGGAAGG - Intergenic
945210969 2:207381470-207381492 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
945409083 2:209488126-209488148 ATGGAGGTCGAGCAGAAGCAGGG + Intronic
945897363 2:215498723-215498745 ATCGACAAGCAGCAGAAGGCAGG - Intergenic
946016143 2:216605671-216605693 CTGGAGGGCCACCAGAAGGAGGG + Intergenic
946528526 2:220546538-220546560 AAGAAGGAGAAGGAGAAGGAAGG - Intergenic
946773525 2:223113482-223113504 ATGGATTAGCAGCTGAAGAATGG + Intronic
946783629 2:223219508-223219530 AATGAGGAGGTGCAGAAGGAAGG - Intergenic
947013090 2:225587734-225587756 ATGGTGGAGCTCCAGAAGCAGGG + Intronic
947118285 2:226794784-226794806 ATGTAGGAGCAGCCACAGGAGGG - Intronic
947239768 2:227981757-227981779 ATGCATGAGGAGCAGAAGGATGG - Exonic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947395927 2:229686623-229686645 ATGGAGGAGCAGCAGAAGACAGG - Intronic
947488399 2:230573130-230573152 AGGGAGGAGCAGCAGCAGGGTGG + Intergenic
947598804 2:231431789-231431811 ATGGTGGAGCAGGATATGGAAGG + Intergenic
947786765 2:232829684-232829706 AAGGGGGACCATCAGAAGGAAGG - Intronic
947837735 2:233187812-233187834 AGGGAGGAGGAGCAGGAGGACGG - Intronic
948772135 2:240257060-240257082 ATGGTGGAGCAGCACATGGGAGG + Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
948939611 2:241189327-241189349 ATGGAGGCGCCGCAGGAGGTCGG - Intronic
949072863 2:242036554-242036576 ATGGGGGAGCAGCAGAGTGAGGG - Intergenic
1168878920 20:1189908-1189930 AAGAAGGAGGAGGAGAAGGAGGG - Intergenic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169208455 20:3752888-3752910 ATGGAAGAGCAGCTGGAGGGTGG + Exonic
1169291440 20:4356627-4356649 CTGGAGGTGAAGCAGAAGGAAGG - Intergenic
1169585984 20:7086048-7086070 ATGGAGGAGGAAAAGAAGGAAGG - Intergenic
1169960418 20:11153058-11153080 ATGGAGGGCAAGCAGAAGCAGGG - Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170306335 20:14942330-14942352 AAGAAGGAGGAGGAGAAGGAGGG - Intronic
1170536546 20:17346407-17346429 TGGGAGGAGGAACAGAAGGATGG - Intronic
1170706064 20:18745677-18745699 ATGGAGGAATTGCAGAAGGGTGG + Intronic
1170907431 20:20528652-20528674 ATGGTGGGGTAGCAGATGGATGG - Intronic
1170945763 20:20889737-20889759 GTGGAGGAGCAGCAGAGGGCAGG - Intergenic
1171070485 20:22063301-22063323 GAGGAGGAGGAGGAGAAGGAAGG - Intergenic
1171273599 20:23835598-23835620 ATGGAGGGTGAGCCGAAGGAGGG + Intergenic
1171307696 20:24120197-24120219 ATGCAAGAGAAGCTGAAGGAGGG + Intergenic
1171822667 20:29868392-29868414 ATGGAGAATCAGGAGAAAGAAGG + Intergenic
1172065795 20:32219390-32219412 ATGGTGAAGGAGCAGAAAGAAGG + Intronic
1172347346 20:34213157-34213179 ATGGAGGAGAAGGAGCAAGAAGG - Intronic
1172517941 20:35548618-35548640 ATGCAGGAGCAGAAGAATGAAGG + Exonic
1172580688 20:36044984-36045006 AAGGAGGGGCAGCAAAAGAAAGG + Intergenic
1172796388 20:37542059-37542081 ATGGTGGAACATCAGAATGATGG + Intergenic
1173053942 20:39593034-39593056 ATGGAGTAGCTGCAGAATGAAGG + Intergenic
1173200881 20:40954348-40954370 TAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1173344285 20:42184499-42184521 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1173667748 20:44774842-44774864 ATGGAGAGGCAGCAGACGCAAGG - Intronic
1173848519 20:46203012-46203034 GAGGAGGAGCAGCAGCAGCATGG - Intronic
1173990971 20:47303183-47303205 ATGGGTGAGGAGCAGCAGGAAGG + Intronic
1174275508 20:49400967-49400989 ATGGATGAATAGAAGAAGGAAGG - Intronic
1174352895 20:49981219-49981241 ATGTTGGAGGAACAGAAGGAAGG + Intergenic
1174476637 20:50800438-50800460 ATGGAGGAGCTGCTGAGGGGCGG + Intronic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1174898565 20:54475573-54475595 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1175176818 20:57117519-57117541 ATGGTGGCTCTGCAGAAGGAAGG + Intergenic
1175429383 20:58891271-58891293 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1175458926 20:59136236-59136258 ATGAAGCAGCAGCAGAGGGTAGG - Intergenic
1175485003 20:59339476-59339498 ATGGAGGAGAGGGACAAGGAAGG + Intergenic
1175514903 20:59563172-59563194 ATGAAGGAGAAGGCGAAGGATGG + Intergenic
1175582799 20:60113446-60113468 AAGAAGGAGCAGGAGAAGCATGG + Intergenic
1175682827 20:61003593-61003615 ATTGAGAAGTGGCAGAAGGAGGG - Intergenic
1175807454 20:61837810-61837832 GAGGAGGAGGAGGAGAAGGAAGG - Intronic
1175844209 20:62050201-62050223 AGGGCACAGCAGCAGAAGGAAGG + Intronic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1177136295 21:17308443-17308465 ATGGAGGGTGAGCCGAAGGAGGG + Intergenic
1178348321 21:31851155-31851177 TTGGAGGAGCAGAGGAGGGAGGG - Intergenic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178505257 21:33157404-33157426 AGGGAGGAGGAGGAGAAAGAGGG - Intergenic
1178505262 21:33157423-33157445 AGGGAGGAGGAGGAGAAAGAGGG - Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179277606 21:39906543-39906565 AAGAAGGAGGAGCGGAAGGAAGG - Intronic
1179406198 21:41127834-41127856 ATGGAGGACCCGGGGAAGGAGGG - Intergenic
1179548613 21:42128548-42128570 ATAGAGAAGCAACACAAGGAAGG + Intronic
1180059091 21:45375504-45375526 ATGGAGGAGGGGGAGGAGGAGGG + Intergenic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1180676223 22:17588235-17588257 AGGGATGAGAAACAGAAGGAAGG - Intronic
1180729765 22:17972644-17972666 TTGGGGCAGCAGGAGAAGGAAGG + Intronic
1181330292 22:22085894-22085916 AGGGAGGAGCCACAGAAGAAAGG + Intergenic
1181382138 22:22514283-22514305 TTGGAGGCACAGCAGAAGGAGGG - Exonic
1181528386 22:23502588-23502610 ATGGAGGAATGGCAGATGGAGGG - Intergenic
1181570216 22:23764301-23764323 CTGGAGGAGGACCTGAAGGAAGG + Exonic
1181786029 22:25227931-25227953 ATGGACCAGCAGCCGAAGGACGG + Exonic
1181877638 22:25952488-25952510 ATAGATGAGTAGTAGAAGGATGG - Intronic
1182016633 22:27045879-27045901 ATGGAGAGGCCGCAGAATGAGGG - Intergenic
1182370573 22:29807466-29807488 ATGGAGTAACAGCTGAGGGAAGG + Intronic
1182466786 22:30521911-30521933 AAGGAGGAGGAGGAGAGGGAGGG - Intergenic
1182550563 22:31098809-31098831 ATTGAGAAGCTGGAGAAGGAGGG + Exonic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1182755876 22:32678530-32678552 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1182915515 22:34025867-34025889 AAGAAGGAGAAGGAGAAGGAGGG - Intergenic
1183043141 22:35198339-35198361 GAGGTGGAGGAGCAGAAGGAGGG - Intergenic
1183339871 22:37274199-37274221 AAGGGGGAGCAGCAGAGGGATGG - Intergenic
1184208859 22:43023513-43023535 TTGGAGGCTCAGCAGAAGAAGGG - Intergenic
1184449471 22:44574513-44574535 AAGGAGGAGAAAGAGAAGGAGGG + Intergenic
1184505604 22:44899629-44899651 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
1184591017 22:45483367-45483389 ATGTAGCAGCAGCAGTGGGAAGG - Intergenic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184837009 22:47029735-47029757 AAGGAAGAGCAGCAGAATCATGG - Intronic
1185131924 22:49044206-49044228 GTGGAGGAGCAGCTGAAACAGGG - Intergenic
1185420042 22:50730151-50730173 ATGGAGCAGCAGCACATGCAGGG - Intergenic
949803965 3:7934329-7934351 ATGGAGGACAAGCTGAAGCAGGG + Intergenic
949952155 3:9238224-9238246 ATGGAGGAGATGGAGAAGGAAGG + Intronic
950020943 3:9787270-9787292 CTGCTGGAGGAGCAGAAGGATGG - Exonic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950458290 3:13105598-13105620 ATGGAGGGGCAGTGGAGGGAAGG - Intergenic
950590621 3:13933709-13933731 ATGGAGTAGCTGTAGAAGGGGGG + Intergenic
950635783 3:14313506-14313528 ATTGAGGAGGAGAGGAAGGAAGG - Intergenic
950711802 3:14818526-14818548 ATGGAGTAGCTGTAGAAGGGGGG + Intergenic
950944511 3:16930799-16930821 ATGCAGGAGCAGCAGACTTAAGG - Intronic
951455505 3:22887859-22887881 ATGGAGGAGCTGTTGAAGGCTGG - Intergenic
951676522 3:25247619-25247641 ATGGAGGATGAGCAGAAGCAGGG - Intronic
951704344 3:25528527-25528549 CTGGAGGAGGAGTAGAAGGAAGG + Intronic
951741599 3:25931323-25931345 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
951826583 3:26875654-26875676 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
952056811 3:29457157-29457179 ATGGAGGTGGAGAAGAAGGGAGG - Intronic
952343296 3:32462990-32463012 ATGGAGGTGCAGGATATGGAAGG + Intronic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952708289 3:36402287-36402309 ATGGAGGGGAAGAAGAAGGAAGG + Intronic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
953295541 3:41711858-41711880 ATGGAGGACCAAAAGAAGCATGG + Intronic
953374289 3:42415741-42415763 AAGAAGGAGAAGGAGAAGGAGGG + Intergenic
953484067 3:43277957-43277979 GAGGAGGAGGAGGAGAAGGAAGG + Intergenic
953555868 3:43946356-43946378 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
953592211 3:44269348-44269370 AGGGAGGAGAAGGAGGAGGAGGG - Intronic
954264493 3:49461853-49461875 GAGGAGGAGGAGGAGAAGGAGGG - Intergenic
954318282 3:49813122-49813144 CTGGAGGAGCAGCTGAAGGTGGG - Exonic
954524861 3:51261257-51261279 ATGGAGGGCAAGCAGAAGGAGGG + Intronic
954649660 3:52153485-52153507 AGGGAGGAGCAGCTGGGGGAGGG + Intronic
954836542 3:53473917-53473939 ATGGAGGACAAGCTGAAGCAGGG - Intergenic
955086588 3:55708761-55708783 ATGGAGGAGTGGAAGAAGAAAGG + Intronic
955103518 3:55874706-55874728 ATGGAGAAGCTACAGAAGTAGGG + Intronic
955241841 3:57185424-57185446 ATTGAGGAGCAACAGCAGGCAGG - Intergenic
955410633 3:58653367-58653389 AGGGAGGAAGAACAGAAGGAAGG - Intronic
955468057 3:59256653-59256675 ATCGATGAGGGGCAGAAGGAGGG + Intergenic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
956134479 3:66085454-66085476 TTGGAGGAGGAGGAGAAGGGAGG - Intergenic
956290418 3:67654645-67654667 GAGGAGGAGCAGCGGGAGGAGGG + Intergenic
956308865 3:67856934-67856956 ATGGACCAGCAGCAGCAGCATGG + Intergenic
956554092 3:70498543-70498565 ATGAAGGAGCACCAGAACAAAGG - Intergenic
956864654 3:73357086-73357108 AGGGAGGGTCAGAAGAAGGAAGG - Intergenic
957011354 3:75009193-75009215 ATGGAGGGCCAGCAGAAGCAGGG - Intergenic
957344305 3:78942452-78942474 ATGGAGGACAAGCAGAGGGTAGG + Intronic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957747758 3:84366598-84366620 ATGGAGGGCCAGCAGAAGCAGGG - Intergenic
957850515 3:85800705-85800727 ATGGAGGGCGAGCAGAAGTAGGG - Intronic
957993339 3:87654172-87654194 ATGGAGGGCAAGCAGAAGCATGG - Intergenic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
958154594 3:89740352-89740374 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
958584092 3:96062829-96062851 GAGGAGGAGAAGGAGAAGGAGGG - Intergenic
958586155 3:96091017-96091039 ATGGAGGACAAGCAGAAGTGGGG + Intergenic
958682173 3:97344907-97344929 ATGAAGGAACAAAAGAAGGAAGG + Intronic
959345665 3:105191474-105191496 ATGGAGGGCAAGCAGAAGCAGGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960044872 3:113186899-113186921 ATGGAGGAGCAGGAGGCTGAGGG + Intergenic
960313116 3:116141454-116141476 ATGGAGGAGAGGGAGAAGAAAGG - Intronic
960465342 3:117990915-117990937 ATTGAGGAATAGCTGAAGGAAGG - Intergenic
960760164 3:121064270-121064292 ATCGAGGAGGAGCAGAAGCAGGG - Intronic
960836438 3:121911456-121911478 ATGGAGGAGGAGGAGGAGGGAGG - Intronic
960899664 3:122542225-122542247 AAGGAGGAGGAGGAGAAGAAAGG - Intronic
960986204 3:123282675-123282697 AGGATGGAGCAGCAGAAGCACGG + Exonic
961661680 3:128472168-128472190 ATGGAGGAGCAGCCCCAGCATGG + Intergenic
961687044 3:128640766-128640788 ATGGAGGAGGAGGCAAAGGAAGG - Intronic
961820177 3:129571874-129571896 GTGGGTGAGCAGCAGAAGGCAGG - Intronic
961935197 3:130575636-130575658 ATGGAGGAGCACCTGGAAGATGG - Intronic
961952894 3:130769358-130769380 ATGGAGATGGAGTAGAAGGATGG + Intergenic
961977430 3:131041944-131041966 ACGGAGGGCGAGCAGAAGGAGGG + Intronic
962156762 3:132956546-132956568 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
962264507 3:133935480-133935502 AAGGGGCAGCAGCAGAAAGAAGG - Intronic
962315170 3:134354749-134354771 AGGGAGGAGCAGCTGTGGGAGGG + Intergenic
962384299 3:134920638-134920660 ATGGAGGAGCTGTAAAAAGAGGG + Intronic
962419590 3:135216254-135216276 ATGTAGCAGCATCAGAATGAGGG - Intronic
962770423 3:138606252-138606274 AAGGAGGAGGAGCAGGAGAAAGG + Intergenic
962851008 3:139308390-139308412 AGGAAGGGGCAGCACAAGGATGG - Intronic
963460004 3:145600036-145600058 GAGGAGGAGAAGGAGAAGGAGGG + Intergenic
963595264 3:147317603-147317625 ATGGAGCATGAGCCGAAGGAGGG - Intergenic
963652927 3:148006931-148006953 ACGGAGGAGGAGGAGAGGGAGGG - Intergenic
963711817 3:148755212-148755234 ATGGGGGAGCAGGAGAAGAAAGG - Intergenic
963988220 3:151622480-151622502 AAGGAGGAGAAGAAGAAAGATGG - Intergenic
964391326 3:156201113-156201135 ATGGAGGGTGAGCAGAAGCAGGG - Intronic
964392090 3:156208309-156208331 AAGGAGGAGCATCAAAAAGAAGG - Intronic
964434281 3:156635687-156635709 ATGGAGGAAAGGCAGAGGGAGGG - Intergenic
965091162 3:164163730-164163752 ATGGAGGGCTAGCAGAAGCAGGG - Intergenic
965333139 3:167402002-167402024 ATGCAGGACGAGCAGAAGAATGG + Intergenic
965551267 3:169967071-169967093 GTGGAGCAGCAGGGGAAGGAAGG + Intronic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
966291107 3:178360953-178360975 ATGGAGGGCAAGCAGAAGCATGG + Intergenic
966877507 3:184331550-184331572 CTGGAGAAGCTGCTGAAGGAGGG + Exonic
966970804 3:185043782-185043804 ATGAAGGATCCCCAGAAGGAGGG + Intronic
967249249 3:187520068-187520090 GAGGAGGAGAAGGAGAAGGAAGG + Intergenic
967486835 3:190042095-190042117 ATGGTGGAGGAGTAGAGGGAGGG + Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968565324 4:1309571-1309593 CTGGAGGAGGAGCAGAGGCAGGG + Intronic
969233889 4:5851694-5851716 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
969235930 4:5865065-5865087 ATGGAGGAGGAGGAGGAGGCTGG - Intronic
969617125 4:8260183-8260205 GAGGAGGAGCAGGAGAGGGAAGG - Intergenic
969838137 4:9860165-9860187 AGGGAGGAGAAGGAGGAGGAAGG - Intronic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970099141 4:12501318-12501340 AAGGAAGAGGAGAAGAAGGAAGG + Intergenic
970099156 4:12501382-12501404 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
970107832 4:12605009-12605031 ATAGGGAAGCAGGAGAAGGAAGG - Intergenic
970195578 4:13547600-13547622 GCGGAGGAGAAGCAGGAGGAGGG - Intergenic
970341852 4:15115683-15115705 AGGGAGGAGGAGGAGAAGGAAGG - Intergenic
970418532 4:15882963-15882985 AGAGAGGAGGAGCAGAAGCAAGG + Intergenic
970679289 4:18489021-18489043 ATGGAGGGCAAGCAGAAGCAGGG + Intergenic
971094925 4:23389883-23389905 ATGGAGGAGCACATGAATGAAGG + Intergenic
971132470 4:23827874-23827896 AAGGAGGAGAAGGAGAAAGAAGG + Intronic
971574540 4:28256593-28256615 AGGGAGGAGGAGGAGGAGGAGGG - Intergenic
971749120 4:30623870-30623892 ATGGAGGGCGAGCAGAAGCAGGG + Intergenic
972372532 4:38438496-38438518 ATGGAGGGCAAGCAGAAGCAGGG - Intergenic
972629773 4:40833111-40833133 AGGGAGGAGAACCAGAAGCAAGG - Intronic
972917391 4:43897469-43897491 ATGGAGAATGAGCAGAAGCAGGG - Intergenic
973180112 4:47256671-47256693 ATGGTGGAGCAGGAGAGAGAGGG + Intronic
973673654 4:53241755-53241777 ATGGTGGTGCAGCAGGAGGAGGG - Intronic
973966670 4:56170088-56170110 ATGGAGGAGGAAGAGGAGGAAGG - Intergenic
974247093 4:59333852-59333874 ATGGTGGAAGAGCAGAAGGAAGG - Intergenic
974926537 4:68305630-68305652 AAAGAGGAGGAGGAGAAGGAAGG + Intergenic
974962838 4:68725013-68725035 ATGGATAGGTAGCAGAAGGAGGG + Intergenic
975524167 4:75331143-75331165 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
975620409 4:76290903-76290925 ATGGAGGGTGAGCAGAAGTAGGG - Intronic
975638699 4:76477818-76477840 ATGGAGGGTGAGCAGAAGCAGGG + Intronic
976052723 4:81028434-81028456 TTGGAGGTGCAGCAAAGGGAAGG + Intergenic
976695800 4:87918705-87918727 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
978148685 4:105409069-105409091 ATGGAGGGCGAGCAGAAGCAGGG + Intronic
978384812 4:108168482-108168504 AAGGAGGAGGAGCAGAAGATGGG + Intronic
978651565 4:111011675-111011697 AGGGCAGAGCAGCAGAAGCAGGG - Intergenic
978702307 4:111662589-111662611 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
978912686 4:114082977-114082999 ATGGAGGAGCCCAAGAATGAAGG + Intergenic
979012247 4:115387089-115387111 ATGGAGGGTGAGCAGAAGTAGGG + Intergenic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979375467 4:119941556-119941578 TAGGAGTAGCAGCAGAAGAAGGG - Intergenic
979626512 4:122851038-122851060 ATGGGGGAGCAGGGGAAGTAGGG - Intronic
979668363 4:123336993-123337015 ATGGAGGGCGAGCAGAAGCAGGG - Intergenic
979811133 4:125037747-125037769 ATGCAGGAGAGGCGGAAGGAAGG - Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980148678 4:129021096-129021118 ATGGAGGATGAACAGAAGTAGGG + Intronic
980190662 4:129520370-129520392 ATAGAGGAGAAGGAGAAGGAAGG + Intergenic
980425640 4:132624470-132624492 ATAGAGAAGAAGGAGAAGGAAGG - Intergenic
980463961 4:133150766-133150788 GGGGAGGAGTAGGAGAAGGAGGG + Exonic
980494244 4:133570587-133570609 ATGGAGGGCAAGCAGAAGCAGGG - Intergenic
980634010 4:135474259-135474281 ATGGAGGGCGAGCAGAAGCAGGG - Intergenic
980884957 4:138752352-138752374 ATGGAGGAGCAGGAGAGAGAGGG - Intergenic
981131501 4:141162648-141162670 ATGGAGGACAAGCAGAAGCAGGG + Intronic
981254379 4:142644235-142644257 AAGGAGGAGAAAGAGAAGGAAGG + Intronic
981514027 4:145587770-145587792 GTGGAGGAGGAGGAGAAGGAAGG + Intergenic
982196939 4:152925876-152925898 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
982226253 4:153170161-153170183 GTGGAGGAGAAGGAGAATGAAGG + Intronic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
982720525 4:158855058-158855080 AAAGAGGAGTAGGAGAAGGAAGG + Intronic
982815469 4:159878223-159878245 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
983044603 4:162970170-162970192 ATGGAGGGCCAGCAGAAGCAGGG - Intergenic
983543206 4:168935118-168935140 ATGGAGGGCGAGCAGAAGCAGGG + Intronic
983547498 4:168979102-168979124 AAGGAGGAGTAACAGGAGGAGGG - Intronic
983840776 4:172455056-172455078 ATGGAGGGTGAGCAGAAGCAGGG + Intronic
984111708 4:175625070-175625092 TTACAGGAGCAGCAGAAGAAGGG - Intergenic
984714865 4:182916759-182916781 AGGGAAGAGCAGGAGAGGGAAGG + Intronic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
984864232 4:184267667-184267689 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
984908865 4:184653223-184653245 TTCCAGGAGCAGCTGAAGGAGGG - Intronic
985052023 4:186000544-186000566 ATGGAGGAAAAGAAGATGGAAGG - Intergenic
985884340 5:2664981-2665003 AGAGAGGAGCAGAAGAAGGCTGG + Intergenic
986358457 5:6951961-6951983 ATGGAGGGCAAGCAGAAGCAGGG + Intergenic
986879105 5:12147877-12147899 AAGGAGGAGGAGGAGGAGGATGG - Intergenic
986879511 5:12153353-12153375 ATGGAGGGCAAGCAGAAGCAGGG + Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
987931596 5:24406558-24406580 ATGGAGGATCATCTGAAGGATGG + Intergenic
988255767 5:28818379-28818401 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
988289721 5:29270183-29270205 ATGGAGGGCTAGCAGAAGCAAGG + Intergenic
988427785 5:31083687-31083709 AAGGAGGAGGAGGAGAAGAAAGG + Intergenic
989345332 5:40423187-40423209 ATGGAGGATGAGCCGAAGCAGGG - Intergenic
989358115 5:40567362-40567384 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989519824 5:42388546-42388568 GTGGAGGAGCTGGAGAAGAATGG - Intergenic
989568617 5:42925023-42925045 AAGGAGGACGAGGAGAAGGAAGG - Intergenic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
990244923 5:53854673-53854695 ATGGAGGATGAGCTGAAGCAGGG - Intergenic
990409385 5:55525721-55525743 AGGGAAGATGAGCAGAAGGAAGG + Intronic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
990745942 5:58959383-58959405 ATGGAGGGCGAGCCGAAGGAGGG - Intergenic
990822431 5:59857851-59857873 AAGGAGGGAGAGCAGAAGGAAGG + Intronic
991860882 5:71011993-71012015 ATGTAAGAGCAGTAGAAGGAGGG + Intronic
991917360 5:71618360-71618382 ATGGTGGAACAGCAGAAGGTGGG - Intronic
991927435 5:71719194-71719216 AGGGAGGAGGCGAAGAAGGAAGG - Exonic
992201011 5:74383977-74383999 GTGGATGAGGAGGAGAAGGAGGG + Intergenic
992287206 5:75247987-75248009 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
992334867 5:75756212-75756234 AGGGAGGAGCAGCAGAGGTTGGG + Intergenic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
992375147 5:76181585-76181607 ATGGTGGAGCAGGAGAGAGAGGG + Intronic
992554035 5:77885736-77885758 AGGGAGGAGCGGGAGAAAGAAGG + Intergenic
992576252 5:78116801-78116823 GTGGAGGGGCAGTAGAAGCAAGG - Intronic
992740703 5:79770586-79770608 ATGGAGGGTGAGCAGAAGCAGGG - Intronic
992873447 5:81028822-81028844 ATGGAGCATGAGCAGAAGCAGGG + Intronic
993569182 5:89515018-89515040 AAGGAGGAGGAGGAGAAGGAAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
995350824 5:111173459-111173481 AAGGAACAGCAGCAGAAGGAAGG + Intergenic
996118212 5:119642550-119642572 TTTGAGGAGAGGCAGAAGGATGG - Intergenic
996400977 5:123062114-123062136 AAGGAGGTGAAGCAGATGGATGG + Intergenic
996426702 5:123320612-123320634 ATAGAGGATGAGCAGAAGAAGGG - Intergenic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
996552675 5:124746814-124746836 AGGGAGGAGGAGGAGAAGAAAGG + Intronic
997214647 5:132100761-132100783 ATGCAGGTGCAGCTGGAGGAAGG - Intergenic
997716756 5:136048363-136048385 ATGGAGGGTCAGAAGAGGGAAGG - Intronic
997889186 5:137659990-137660012 GAGGAGGAGGAGGAGAAGGAAGG - Intronic
997896650 5:137724687-137724709 ATGGAGGAGCAGGGGAAGAAAGG - Intronic
997966610 5:138361960-138361982 CTTGGGGAGCAGCAGATGGAGGG + Intronic
998226763 5:140333148-140333170 ATGGAGTAGCACCAGAAGAATGG + Exonic
998342547 5:141431109-141431131 ATGGAGTAGAAGTAGAAGTAAGG + Exonic
998376575 5:141694808-141694830 TGGGGGGAGCAGCAGATGGATGG + Intergenic
998384448 5:141748434-141748456 AGGGAGGAGCAGGGGAGGGAAGG - Intergenic
998395023 5:141812678-141812700 GAGGAGGAGGAGCAGGAGGAGGG + Intergenic
998400294 5:141845322-141845344 GTGGAGGAGGAGCAGGGGGAGGG - Intergenic
998568362 5:143235864-143235886 ATGGAGGAAGAGCAGCAGCAGGG - Intergenic
998584847 5:143416578-143416600 AAGGAGGAGGAAGAGAAGGAGGG - Intronic
999149940 5:149420201-149420223 TGGGAGGAACAGCAGAAGCAGGG - Intergenic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999605544 5:153310376-153310398 AAGGAGGCCCAGCAGAGGGAAGG - Intergenic
999709822 5:154308250-154308272 ATGGTGGGGAATCAGAAGGAGGG + Intronic
1000547976 5:162625553-162625575 ATGGAGGGCTAGCAGAAGCAGGG + Intergenic
1000607214 5:163338028-163338050 ATGGTGGTGCAGGAGATGGAAGG - Intergenic
1000611908 5:163383769-163383791 AGGGAGGAGAGGGAGAAGGAAGG + Intergenic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1000798462 5:165693711-165693733 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
1001333286 5:170777439-170777461 CTGGAGGAGAAGCAGAGGGCTGG - Intronic
1001543711 5:172557113-172557135 AGGGAGCAGAAGCAGGAGGAGGG - Intergenic
1001601437 5:172931468-172931490 ATGGGGGAGCTGCTGAAGGCAGG - Intronic
1002173091 5:177386115-177386137 CTGGAGGAGGAGCAGAAGCCAGG + Exonic
1002288981 5:178187076-178187098 AGGGAGGAGCATGAGGAGGAGGG - Intergenic
1002325056 5:178399213-178399235 AGGGAGGGGCAGCAGAAGGCAGG - Intronic
1002465067 5:179404133-179404155 CTGGAGGAGGAGCAGATGGATGG + Intergenic
1002656014 5:180747817-180747839 ATGGAGGATGAGTGGAAGGAAGG - Intergenic
1002855252 6:1030895-1030917 ATGCAGAAGTAGCAGAATGAAGG + Intergenic
1002904698 6:1438868-1438890 AGGGAGGAGCAGGAGAAGGGAGG - Intergenic
1003167615 6:3694964-3694986 AAGGAGGAGGAGGACAAGGAGGG - Intergenic
1003554176 6:7125414-7125436 ATGGAGGACTAGCAGAAGCCTGG - Intronic
1003681613 6:8263138-8263160 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1003817616 6:9859900-9859922 AAGAAGGAGGAGGAGAAGGACGG + Intronic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1003856939 6:10286042-10286064 GAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004064831 6:12233817-12233839 AGGGAGGAGGAGCGGAAGAAGGG - Intergenic
1004086741 6:12457086-12457108 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1004167124 6:13266677-13266699 TTGGAGGAGCAGGAGCAAGAGGG + Exonic
1004577035 6:16906893-16906915 AAGGAGGAGGAGAGGAAGGAAGG + Intergenic
1004945583 6:20609260-20609282 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1004993763 6:21168231-21168253 GAGGAGGAGGAGCAGAAGGCTGG - Intronic
1005376567 6:25188462-25188484 ATGGAGGCACAGTAGAAAGATGG - Intergenic
1005778438 6:29162310-29162332 ATGGAGGGCAAGCAGAAGAAGGG - Intergenic
1005844906 6:29769635-29769657 ATTGAGGAGCAGGAGACTGAGGG + Intergenic
1005859902 6:29892300-29892322 ATTGAGGAGCAGGAGACTGAGGG + Intergenic
1005979194 6:30823434-30823456 AAGGAGGAGAAGAAGAAGAAGGG - Intergenic
1005987372 6:30883536-30883558 GAAGAGGAGCAGGAGAAGGATGG - Intronic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006307459 6:33232369-33232391 GTGGAAGAGCAGCCGATGGAGGG + Intergenic
1006455990 6:34132220-34132242 ATGGAAGAAGGGCAGAAGGAAGG + Intronic
1006815989 6:36850353-36850375 GTGGAGGCGCAGCAGGAGGAAGG - Intergenic
1007506507 6:42339292-42339314 AAGGAGGTGAAGCAGATGGAAGG - Intronic
1007582870 6:42969594-42969616 CTGGAGGAGCAGCAGCCAGATGG - Intronic
1007751282 6:44073459-44073481 ATGGAGGAGACGCACAAGGGAGG - Intergenic
1007853467 6:44829129-44829151 TTGGAGGAACAGGAAAAGGAGGG + Exonic
1008407677 6:51136737-51136759 ACGGAGGGTGAGCAGAAGGAGGG - Intergenic
1008711008 6:54227126-54227148 ATGGCGGAGCAGGAGAGTGAAGG - Intronic
1008719065 6:54327294-54327316 ATGGAGGGTGAGCAGAAGCAGGG + Intronic
1008879592 6:56367570-56367592 ATGGCAGAGCAGCAGAAAGTAGG + Intronic
1009043109 6:58205288-58205310 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009045963 6:58237767-58237789 ATGGAGATGCAGCAAAAGCATGG - Intergenic
1009218946 6:60959537-60959559 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009221780 6:60992080-60992102 ATGGAGATGCAGCAAAAGCATGG - Intergenic
1009305983 6:62089525-62089547 AAGGAGGGCGAGCAGAAGGAGGG - Intronic
1009860651 6:69326774-69326796 GTGGAGGAAGAGGAGAAGGAGGG + Intronic
1010063709 6:71655504-71655526 ATGGGAGAGCAGCAGAAAGTGGG - Intergenic
1010179800 6:73073115-73073137 ATGGAGGAGGAACAGAAAGGGGG - Intronic
1010294418 6:74179625-74179647 AAGGAGGAGGAAGAGAAGGAAGG - Intergenic
1010985136 6:82414855-82414877 CTGGAGGAGCAGCAGTGGGAGGG + Intergenic
1011120004 6:83942316-83942338 ATGGAGGGCGAGCAGAAGCATGG + Intronic
1011235657 6:85213455-85213477 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
1011279208 6:85660227-85660249 ATGGAGGTGGAGCTGAAGAAGGG - Intergenic
1011287806 6:85743763-85743785 ATGGTGGAGCAGGAGAATGAAGG - Intergenic
1011484802 6:87830171-87830193 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1011831316 6:91374990-91375012 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
1012083160 6:94785738-94785760 ACGGAGGATGAGCAGAAGCAGGG - Intergenic
1012349244 6:98231185-98231207 AAGGAAGAGCAACACAAGGAAGG - Intergenic
1013305921 6:108847078-108847100 GAGGAGGAGGAGGAGAAGGAAGG - Intergenic
1013325234 6:109039078-109039100 AGGGAGGAAAAGGAGAAGGAGGG + Intronic
1013325238 6:109039097-109039119 AGGGAGGAGAAGGAGAAGGAAGG + Intronic
1013393747 6:109713560-109713582 ATGGCAGTGCAGCTGAAGGAGGG + Intronic
1013523333 6:110952646-110952668 AGGGAGGAGAAGGAGAGGGAGGG - Intergenic
1013860891 6:114633956-114633978 ATGGAGGATGAGCTGAAGCAGGG - Intergenic
1014278759 6:119417809-119417831 ATGGAGGGCAAGCAGAAGCAGGG + Intergenic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1014836636 6:126167412-126167434 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
1015180398 6:130355744-130355766 ATGGAGAAGCACCAGTAAGAGGG + Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015414327 6:132931718-132931740 ATGGGGGAGCTGGAGAAGGGAGG - Intergenic
1016095882 6:140036581-140036603 CAGGAGAAGCAGCAGAAGAAAGG - Intergenic
1016277009 6:142365685-142365707 AGGGAGGAAGAGCAGGAGGAGGG + Intronic
1016528907 6:145036630-145036652 ATGGAGGAGGAGCCACAGGACGG - Intergenic
1016794723 6:148105753-148105775 ATGGAGGAGAAGGAGGAAGATGG + Intergenic
1016801564 6:148174224-148174246 ATGGTTGAGGAGCAGAGGGATGG + Intergenic
1016832471 6:148447623-148447645 GAGGAGGAGGAGGAGAAGGAAGG - Intronic
1016865431 6:148761291-148761313 AGGGAGGCGGAGCAGAAGGCAGG - Intronic
1016881505 6:148916614-148916636 ATGAAGGAGCGGCAGAAAGGAGG - Intronic
1016881689 6:148917783-148917805 ATGAAGGAGCGGCAGAAAGGAGG + Intronic
1017037584 6:150280367-150280389 GTGGAGGAAGAGCAGGAGGAAGG - Intergenic
1017209401 6:151838219-151838241 CCGAAGGAGCAGAAGAAGGATGG + Intronic
1017297236 6:152812085-152812107 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1017634557 6:156431145-156431167 GTGGAGGAACAGCAGTAGAAAGG - Intergenic
1017727794 6:157287661-157287683 AGGGAGGAGGAGGGGAAGGAAGG - Intergenic
1017853553 6:158328169-158328191 TTGGAGGAGCAGGAGGAGGGAGG + Intronic
1017994888 6:159523365-159523387 GTGGAGGAGTAGGAGAAGAAGGG - Intergenic
1018012675 6:159685966-159685988 ATGGAGGCGTAGAAGAAGGAGGG - Intronic
1018038111 6:159898783-159898805 AGGGAGGAGAAGGAGAAGAAGGG - Intergenic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018569079 6:165188068-165188090 ATGGAGGCGGAAGAGAAGGAGGG - Intergenic
1018582791 6:165322097-165322119 TTGGAGGAGAAGCATTAGGAAGG - Intergenic
1018681311 6:166268281-166268303 GTTGAGGAGAAGGAGAAGGAGGG + Intergenic
1018740152 6:166722380-166722402 ATGGAGGAGCCGCAGGGGGTGGG + Intronic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1019021907 6:168925920-168925942 AGGAAGGAGCAGAAGATGGAAGG - Intergenic
1019389994 7:781205-781227 ATGGAGATAGAGCAGAAGGATGG - Intronic
1019427764 7:985370-985392 ATGGGCGTGCAGCAGGAGGACGG + Intronic
1019471868 7:1225343-1225365 CTGGAGTGGCGGCAGAAGGAGGG + Intergenic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1019865849 7:3709371-3709393 AAGTAGGAGCAGCAGAAGGAAGG - Intronic
1020339072 7:7089575-7089597 ATGGAGGGTAAGCAGAAGCAGGG - Intergenic
1020410710 7:7888864-7888886 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1020994475 7:15245484-15245506 AGGGAGGATCAGAAAAAGGAAGG - Intronic
1021028063 7:15694163-15694185 ATGGGGGAAAAGGAGAAGGAAGG - Intergenic
1022131282 7:27406858-27406880 GTGGAGGAGAAGCAGAGGGAAGG + Intergenic
1022363942 7:29690997-29691019 TTGGTTCAGCAGCAGAAGGATGG - Intergenic
1022697425 7:32722732-32722754 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1022802051 7:33786142-33786164 AAGGAGGAGCAGGAGAAGAGAGG + Intergenic
1022827357 7:34029424-34029446 ATGGAGGAGAGGCAAAAGGAAGG + Intronic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1022934681 7:35161234-35161256 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1023156115 7:37254117-37254139 ATGCAGGACCAGCAGAAGGAAGG + Intronic
1023214454 7:37847256-37847278 GAGGAGGAGGAGGAGAAGGAGGG + Intronic
1023214476 7:37847382-37847404 GAGGAGGAGGAGGAGAAGGAGGG + Intronic
1023214507 7:37847577-37847599 ACGGAGGAGGAGGAGAAGGAGGG + Intronic
1023214528 7:37847688-37847710 GAGGAGGAGGAGGAGAAGGAGGG + Intronic
1023779596 7:43643509-43643531 CTGGAGGAGGAGCACAGGGAAGG - Intronic
1024017642 7:45332689-45332711 ATGGAGGGCAAGCAGAAGCAGGG + Intergenic
1024019130 7:45349209-45349231 CTGGAGGATCACCAGGAGGATGG + Intergenic
1024107482 7:46107946-46107968 ATGGAGGAGTTGTAGAATGAAGG - Intergenic
1024171405 7:46791300-46791322 ATGGAGGGGCAGCAAGGGGAAGG + Intergenic
1024233104 7:47377770-47377792 ATGGGGGAGAAGGAGAAGGAGGG - Intronic
1024605356 7:51018438-51018460 ATGGAGGAGCATCAGGAAAAGGG - Intronic
1024664994 7:51537076-51537098 ATGGAGGGCAAGCAGAAGCAGGG - Intergenic
1024828228 7:53417811-53417833 ATGGAGCAGTGGCAGACGGAGGG - Intergenic
1025058040 7:55780956-55780978 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1025887776 7:65614526-65614548 AAGGAGGAGGAGCAGATGGAAGG - Intergenic
1025910779 7:65826700-65826722 ATAGAGGATCAGCATAATGAGGG - Intergenic
1026158963 7:67852272-67852294 AGTGAGGAGGAGCAGAAGGATGG + Intergenic
1026238030 7:68545772-68545794 AAGGAGGAGAAGGAGAAGGAGGG - Intergenic
1026401826 7:70021679-70021701 ATTGAGGAGCAGCAGGAAGGAGG - Intronic
1026740545 7:72975995-72976017 ACGGAGCAGGAGCAGAGGGAGGG + Intergenic
1026797844 7:73377480-73377502 ACGGAGCAGGAGCAGAGGGAGGG + Intergenic
1027103187 7:75389076-75389098 ACGGAGCAGGAGCAGAGGGAGGG - Intergenic
1027354639 7:77343404-77343426 ATGGAGGTGCAGGATATGGAAGG - Intronic
1027572759 7:79891458-79891480 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1028076852 7:86527097-86527119 ATGTTGGACCAGCAGAAGGATGG - Intergenic
1028629225 7:92915607-92915629 ATGCGGCAACAGCAGAAGGACGG + Intergenic
1029830622 7:103254014-103254036 TTGGTTCAGCAGCAGAAGGATGG + Intergenic
1029850612 7:103457615-103457637 ACGGAGGAAGAGCAGAAGCAGGG - Intergenic
1030007776 7:105135434-105135456 AGAGAGCAGCAGCAGAGGGAAGG + Intronic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1030328763 7:108250562-108250584 ATGGAGGTAGAGCAGAAGAATGG + Intronic
1030469601 7:109947122-109947144 TTGGAGGAGGAGAAGAAGTAGGG - Intergenic
1030568564 7:111191938-111191960 AAGCAGGAGCAGGAGTAGGAGGG + Intronic
1030638236 7:111974414-111974436 ATTGAGGAGAAGCAGTGGGAAGG + Intronic
1030853828 7:114525747-114525769 ATTAAGGAGCAGCAGCAGGTAGG - Intronic
1031053790 7:116972131-116972153 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
1031397822 7:121293805-121293827 ATGGAGGGCAAGCAGAAGCAGGG - Intronic
1031613853 7:123857480-123857502 ATGGAGGGCAAGCAGAAGCAGGG - Intronic
1031854601 7:126907184-126907206 AAGGAGGAGGAGCAGATGGAAGG + Intronic
1032034886 7:128514491-128514513 AGGGAGGAGGATCAGAAGGGAGG - Intergenic
1032155547 7:129464689-129464711 TTTGAGGAGTAGCAGAAGCAGGG - Exonic
1032175403 7:129620211-129620233 GAGTAGGAGCACCAGAAGGAAGG + Intronic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032466830 7:132151390-132151412 AAGGAGGAGGAGGAGGAGGAAGG + Intronic
1032497865 7:132376336-132376358 ATGGAGCAGCAGCAGAGACATGG - Intronic
1032523151 7:132561436-132561458 AAGGAGGAGGACAAGAAGGAGGG - Intronic
1032669366 7:134069288-134069310 AAGGAGGAGGAGGAGAATGAGGG - Intergenic
1032705500 7:134418108-134418130 ATGCAGGAGCTGCAAAAGGCTGG + Intergenic
1032908121 7:136396137-136396159 AGGGAGGAGGAGGAGAGGGAAGG + Intergenic
1032957202 7:136984744-136984766 ATGGAGGGCAAGCAGAAGCAGGG - Intronic
1033409974 7:141108572-141108594 ATGGGGGAGCAGGTGATGGAGGG + Intronic
1033432340 7:141300569-141300591 AAGGAGAAGAAGCAGAAGAAGGG - Intronic
1033509424 7:142039980-142040002 TTAGAGGAGAAGCAGAAGAAAGG + Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033615713 7:143012296-143012318 ATGGGGGAGCAAAAGAAGGGTGG - Intergenic
1033832579 7:145271426-145271448 AAGGTGGAGGAGCAGGAGGAGGG + Intergenic
1034314401 7:150116925-150116947 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
1034520303 7:151614311-151614333 ATGGGGGAGCAGCAGCAGGGTGG + Intronic
1034679205 7:152915807-152915829 GGGGAGGAGAAGGAGAAGGAGGG - Intergenic
1034792494 7:153983844-153983866 ATGGAGGGTGAGCAGAAGCAGGG - Intronic
1035348808 7:158228506-158228528 ATGGTGGTGCAGTAGAAGCAAGG + Intronic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1035793981 8:2336754-2336776 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
1035798824 8:2384954-2384976 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
1035958333 8:4108106-4108128 ACGGAGGAGGAGGAGGAGGAGGG + Intronic
1036408779 8:8479169-8479191 TGGGAGGAGGAGGAGAAGGAAGG + Intergenic
1036463514 8:8974789-8974811 AAGAAGGAGAAGGAGAAGGAGGG - Intergenic
1036642408 8:10592631-10592653 AGGCAGGGGCAGCACAAGGACGG + Intergenic
1036661929 8:10714556-10714578 ATGGAGGGGCGGGTGAAGGAAGG - Intergenic
1036747666 8:11421349-11421371 ATGGATGAACAACAGATGGAAGG - Intronic
1037444135 8:18947507-18947529 CTGGAGGAGCAGCAGAACCCCGG - Intronic
1037458165 8:19083901-19083923 ATAGGGGAACACCAGAAGGAAGG - Intronic
1037598401 8:20373614-20373636 GAGGAGGAGGAGAAGAAGGAAGG + Intergenic
1037691276 8:21183426-21183448 AAGGAGGAGGAGGAGAAGAAGGG - Intergenic
1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG + Intergenic
1037818381 8:22123891-22123913 AAGGAGGGGCAGGAGAAGCAAGG + Intronic
1037893206 8:22635043-22635065 ATGCAGGAGAGGCAGCAGGAGGG - Intronic
1038039037 8:23708576-23708598 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038211494 8:25522871-25522893 ATGGAGGATGAGCCGAAGCAGGG + Intergenic
1038902954 8:31864584-31864606 GTGCAGGAGCAGAAGAATGAGGG + Intronic
1038927115 8:32153172-32153194 GTGGAAGAGAAGCAGAAGGCCGG + Intronic
1039226502 8:35393963-35393985 ATGAAGGAGAAGGAGAAGAAAGG - Intronic
1039343065 8:36672377-36672399 ATGGAGGGTGAGCCGAAGGAGGG - Intergenic
1039431495 8:37528645-37528667 TTGCAGGAGCAGCAGAGAGATGG - Intergenic
1039630267 8:39103658-39103680 AAGGAGGTGCAGGAGCAGGACGG - Exonic
1039638634 8:39194346-39194368 ATGGTGGTGCAGCAGAGGGATGG + Intronic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040102037 8:43513993-43514015 AAGAAGGAGCATCAGAAGGCAGG + Intergenic
1040576303 8:48654382-48654404 ATGGAAGAGAGGAAGAAGGAAGG - Intergenic
1040791437 8:51234662-51234684 ATGAAGGAGCAACTGAAGAAGGG + Intergenic
1041067081 8:54092259-54092281 AAGGAGGAGAAGGAGAAAGAAGG + Intronic
1041287221 8:56273383-56273405 ATGGAGGGCGAGCAGAAGCAGGG + Intergenic
1041291159 8:56310101-56310123 AGGAAGGAGGAGGAGAAGGAAGG + Intronic
1041291170 8:56310133-56310155 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041291181 8:56310165-56310187 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041419161 8:57647281-57647303 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
1041486786 8:58386546-58386568 ATGGCAGAGCCGCAGATGGAAGG - Intergenic
1041780125 8:61568768-61568790 AGGGAGGAGCAGCAAAAAGGAGG + Intronic
1041982104 8:63873767-63873789 ATGGACGAACAGAAGAAAGAAGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042757392 8:72230800-72230822 TGAGAGGAGGAGCAGAAGGAAGG - Intergenic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043079690 8:75750719-75750741 AAGGAGAAGCAGGCGAAGGATGG - Intergenic
1043253750 8:78106875-78106897 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1043661977 8:82755094-82755116 ATGTAGGAGCATGTGAAGGAAGG + Intergenic
1044089337 8:87979629-87979651 ATGAAGGGCCAGGAGAAGGAAGG + Intergenic
1044093379 8:88030130-88030152 AAGGAAGAGGAGCAGTAGGAGGG + Intergenic
1044493005 8:92842970-92842992 ATGAAGGAGCAAGAGAAGAAAGG - Intergenic
1044509560 8:93058762-93058784 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
1044552343 8:93526211-93526233 ATGGAAGAGTAGAAAAAGGAGGG - Intergenic
1044595355 8:93953568-93953590 ATGGAGGGCAAGCAGAAGCAGGG - Intergenic
1044972143 8:97630112-97630134 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1046014549 8:108589898-108589920 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
1046808208 8:118503702-118503724 ATGGAGGAAGAGCCCAAGGAGGG - Intronic
1047369667 8:124245844-124245866 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
1047388245 8:124429283-124429305 AAGGAGGAGGAGGAGAAGGAAGG + Intergenic
1047731970 8:127735784-127735806 ACGGAGGAGCAGCAGAGAAAGGG + Intronic
1047852836 8:128877560-128877582 GTGGAGGAGAGGCAGGAGGAGGG + Intergenic
1047870820 8:129079902-129079924 AGGGAGGAGTAACGGAAGGAGGG - Intergenic
1047958990 8:129997119-129997141 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048329097 8:133460242-133460264 ATTGAGGAGCTACAGAGGGAAGG + Intronic
1048359681 8:133687213-133687235 AAGGAAGAGGAGGAGAAGGAGGG - Intergenic
1048417597 8:134243792-134243814 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1049058447 8:140257389-140257411 TTGGAGGAGAAGTAGAAGGAAGG - Intronic
1049356796 8:142193043-142193065 AGGGGGGAGGAGCAGAAGGGAGG + Intergenic
1049469248 8:142768164-142768186 AGGGAGGAGGAGAGGAAGGAAGG + Intronic
1049515019 8:143049704-143049726 AAGGAGGAGGAGCATAAGGAGGG - Intronic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049681565 8:143920912-143920934 GTGGAGGAGCAGGAGCAGAAGGG - Exonic
1049852926 8:144843733-144843755 ATGAGGAAGCAGCACAAGGAGGG + Intronic
1049872453 8:144991096-144991118 ATGGAGAGGGAGCAGAAGCAGGG - Intergenic
1050031679 9:1393247-1393269 ATGGAGGGCTAGCAGAAGCAGGG + Intergenic
1050284246 9:4084588-4084610 AAGGCTGAGCAGCCGAAGGATGG + Intronic
1050377629 9:4989025-4989047 ATTGAGGATAAACAGAAGGAAGG - Intronic
1050963255 9:11765410-11765432 ATGGAGGGCGAGCAGAAGCAGGG + Intergenic
1051148775 9:14058492-14058514 ATGGCAGAGGAGGAGAAGGAGGG + Intergenic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1051679379 9:19591694-19591716 AGGGTGGTGGAGCAGAAGGATGG + Intronic
1051756337 9:20404931-20404953 ATGGAGGATCTGAGGAAGGAAGG - Intronic
1051814240 9:21087065-21087087 ATGGAGGGTAAGCAGAAGGAGGG + Intergenic
1052343581 9:27386054-27386076 AAGGAAAAGCAGCAGCAGGATGG - Intronic
1052366279 9:27615217-27615239 ATGGAGGGTGAGCAGAAGTAGGG - Intergenic
1052506283 9:29358805-29358827 ATGGAGGGTGAGCAGAAGTAGGG + Intergenic
1052628246 9:31004595-31004617 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
1052750321 9:32483511-32483533 TTGGGGAAGTAGCAGAAGGATGG - Intronic
1052814666 9:33092251-33092273 AAGGAGGAGAAGTAGAAGGAGGG - Intergenic
1052830617 9:33212255-33212277 AAGAGGGAGCAGCAGAAGAAGGG + Intergenic
1052830618 9:33212258-33212280 AGGGAGCAGCAGAAGAAGGGAGG + Intergenic
1052835731 9:33248667-33248689 GTTGAGGAGCACCAGAGGGACGG - Intronic
1052988846 9:34506821-34506843 TTGGCTGAGCTGCAGAAGGAGGG - Exonic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053037798 9:34840410-34840432 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1053245073 9:36528081-36528103 AGTGAGGAGCTGCAGAAGGGAGG + Intergenic
1053441612 9:38120936-38120958 AAGGAGGAGGAGGAGAAGGTGGG + Intergenic
1053566371 9:39256865-39256887 AGGAAGGAGGAGGAGAAGGAAGG + Intronic
1053750017 9:41243742-41243764 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054255516 9:62808080-62808102 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054335789 9:63807528-63807550 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1054875973 9:70096790-70096812 ATAGAGGAGTAGCAGATAGAAGG + Intronic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055061344 9:72072339-72072361 ATGGAGGGCGAGCAGAAGCAGGG + Intronic
1055600782 9:77916128-77916150 AGGGAGTAGAAGCTGAAGGATGG - Intronic
1055874117 9:80922364-80922386 ATGAAGGAGCAGTAAAAGAAGGG + Intergenic
1055956175 9:81775721-81775743 ATGGAGGATCAGCAGCAGTTTGG - Intergenic
1056040517 9:82660698-82660720 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1056417385 9:86390109-86390131 ATGGAGGATTAGCTGAAGCAGGG + Intergenic
1056666745 9:88587473-88587495 ATTAAGGAGCAGCAGAGGAAGGG + Intergenic
1056813164 9:89780196-89780218 ATGGCTGAGCTGTAGAAGGAAGG - Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057723282 9:97549847-97549869 ATGGAGGATAAGCTGAAGGGAGG - Intronic
1057745199 9:97745664-97745686 CTGGAGGAGAAGGAGAAGGGGGG + Intergenic
1058444577 9:105043431-105043453 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1058593636 9:106591570-106591592 GGGGAGGAGCAGCAGGAGGTGGG + Intergenic
1058730771 9:107847558-107847580 ATGGAGGTGCAGTAGAGGGCAGG - Intergenic
1059431205 9:114251406-114251428 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1060259990 9:122066027-122066049 ATGGGGGTGGAGTAGAAGGAGGG + Intronic
1060283524 9:122228979-122229001 GGGGAGGAGGAGAAGAAGGAGGG - Intronic
1060723282 9:125992160-125992182 CAGGAGGAGCAGCAGAAGCCCGG + Intergenic
1061500604 9:130999438-130999460 AAGGAGGAGAAGGAGAGGGAGGG - Intergenic
1062107231 9:134762381-134762403 TTGGAGGAGCAGAAGAGGGTGGG + Intronic
1062165389 9:135105007-135105029 GAGGAGAAGCAGCAGAAGAAAGG - Intronic
1062190717 9:135246622-135246644 GGGGAGGATGAGCAGAAGGAAGG - Intergenic
1062319901 9:135985810-135985832 ATTCAGGAGGAGCAGGAGGAAGG - Intergenic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062729815 9:138102643-138102665 CAGGAGGAGCGGCAGCAGGAGGG - Intronic
1203375716 Un_KI270442v1:374937-374959 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1185523701 X:760960-760982 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1185550763 X:981100-981122 ATGGAGGAGGACGAGGAGGAGGG + Intergenic
1185603702 X:1355266-1355288 ATGGAGGAAGAGGAGCAGGAGGG + Intronic
1185714475 X:2330177-2330199 GAGGAGGAGAAGCAGGAGGAGGG + Intronic
1186027814 X:5333110-5333132 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186077598 X:5897967-5897989 ATGGAGGAGGAGAGGAAGAAGGG - Intronic
1186124716 X:6400918-6400940 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186313164 X:8342082-8342104 GAGGAGGAGAAGCAGGAGGAGGG - Intergenic
1186332832 X:8554289-8554311 ATGGAGGGCGAGCAGAAGCAGGG + Intronic
1186444024 X:9610605-9610627 ATGCAGAAGCAGCAAAAGAATGG - Intronic
1186490727 X:9970259-9970281 ATGAAGGAGGAACAGAGGGAGGG - Intergenic
1186714963 X:12241917-12241939 AAGAAGGAGAAGGAGAAGGAGGG + Intronic
1186810261 X:13181475-13181497 ATGGAGGGTAAGCAGAAGCAGGG + Intergenic
1186855826 X:13625216-13625238 ATGGAGGTGCAGGAGGAGCAGGG - Intronic
1187265227 X:17726053-17726075 GTGGAGGAGAAGCTGCAGGAGGG - Exonic
1188193128 X:27196827-27196849 ATGGAGGATGAGCAGAAGCAGGG + Intergenic
1188747390 X:33862798-33862820 ATGGAGACAGAGCAGAAGGATGG - Intergenic
1189171386 X:38912988-38913010 ATGGAGGAGTATCAGAGGCAGGG + Intergenic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189557115 X:42156231-42156253 TAGGAGTAGGAGCAGAAGGAAGG + Intergenic
1189897287 X:45668706-45668728 CTAGAGGAGTAGCAGAAGGTAGG - Intergenic
1190257897 X:48777589-48777611 ATGAAGGAATAGAAGAAGGAAGG + Intergenic
1190405353 X:50081352-50081374 AAGGAGGAGCTGGAGAGGGAGGG - Intronic
1190427250 X:50345255-50345277 AGGGAGGAAAAGCAGGAGGAAGG - Intronic
1190622208 X:52298867-52298889 ATGGAGGGCCAGCTGAAGTAGGG + Intergenic
1190627618 X:52352036-52352058 AAGAAGGAGAAGGAGAAGGAAGG - Intergenic
1191059449 X:56279017-56279039 ATGTAGGCACTGCAGAAGGATGG + Intronic
1191657373 X:63613310-63613332 ATGGAGGGCAAGCAGAAGCAGGG + Intergenic
1191846303 X:65550361-65550383 GTGGAGCACCAGCAGGAGGAAGG + Intergenic
1191928768 X:66344948-66344970 ATGGGGGATGAGCAGAAGAAGGG - Intergenic
1191987307 X:66995438-66995460 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
1192192795 X:69002892-69002914 ATGGTGGAAAAACAGAAGGAAGG + Intergenic
1192427806 X:71092848-71092870 ATGTTGGAGCAGAAGAAGGCAGG + Intergenic
1192759274 X:74078349-74078371 ATGGAGGGTGAGCAGAAGCAGGG - Intergenic
1192934031 X:75839547-75839569 ATGGAGGGCAAGCAGAAGCAGGG - Intergenic
1193071811 X:77314533-77314555 ATGGAGGGAAAGCAGAAGCAGGG + Intergenic
1193081671 X:77412338-77412360 ATGGAGGGGGAGCTGAAGCAGGG - Intergenic
1193254103 X:79325980-79326002 ATGGAGGGCAAGCAGAAGCAGGG - Intergenic
1193404397 X:81083778-81083800 ATGGAGGGCAAGCAGAAGCAGGG + Intergenic
1193514313 X:82445440-82445462 ATGGAGGGTGAGCAGAAGCAGGG + Intergenic
1193537395 X:82731226-82731248 ATGGTGGTGCAGCATATGGAAGG - Intergenic
1193571596 X:83151533-83151555 ATGGAGGACGAGCAGAAGCAGGG + Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193841109 X:86409543-86409565 ATGTAGGAGCAGGAGAGAGAAGG - Intronic
1194366369 X:93018993-93019015 AGTGAGGAGCAGCAGAAGCAGGG - Intergenic
1195140020 X:101950013-101950035 ATGGAGGGCAAGCAGAAGCAGGG + Intergenic
1195810709 X:108825507-108825529 ATGGAGGGCAAGCAGAAGCAGGG - Intergenic
1195961321 X:110389789-110389811 AAGGAAGAACAGCAGAAAGAAGG + Intronic
1196054161 X:111336968-111336990 AAGGAGGAGGAGAAGAAGAATGG + Intronic
1196074837 X:111564401-111564423 ATGGAGAAAGAGTAGAAGGATGG - Intergenic
1196395551 X:115258160-115258182 ATGTGGTAGCAGCAGAAAGAGGG - Intergenic
1196473595 X:116057413-116057435 ATGGTGGAGCAGGAGAAAGATGG - Intergenic
1196824710 X:119732019-119732041 CAGCAGGACCAGCAGAAGGAAGG + Intergenic
1197051096 X:122060876-122060898 ACGGAGGGCCAGCAGAAGCAGGG + Intergenic
1197616691 X:128699912-128699934 ATGGAGGAAGAGAAGAAGGGAGG + Intergenic
1197899357 X:131353564-131353586 ATGGGGTAGCAGCAGATGGTTGG + Intronic
1198229169 X:134673274-134673296 ATGGAGGAAGGGAAGAAGGAAGG + Intronic
1198295483 X:135282786-135282808 ATGGAGGGTGAGCAGAAGCAAGG - Intronic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1199209181 X:145186849-145186871 ATGTTGGAGAAACAGAAGGAAGG + Intergenic
1199211376 X:145215417-145215439 AAGGTGGAGCAGCAGATGAAAGG - Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199751549 X:150824131-150824153 GAGGAGGAGGAGAAGAAGGAAGG + Intronic
1199849414 X:151714794-151714816 AAGGAGGAAAAGAAGAAGGAAGG - Intergenic
1199856973 X:151767293-151767315 ATGGCAGAGCAGCAGAATGGTGG - Intergenic
1199907737 X:152251565-152251587 ATGGAAGAGAAGCAAGAGGAAGG - Intronic
1199991398 X:152989577-152989599 AAGGAGGAGCAGGAGGAAGAGGG - Exonic
1200232311 X:154450146-154450168 ATGGAGGAGAAGCCAAGGGAAGG + Intronic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1200674596 Y:6135255-6135277 AGTGAGGAGCAGCAGAAGCAGGG - Intergenic
1201066313 Y:10098629-10098651 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1201224742 Y:11807898-11807920 GAGGAGGAGGAGGAGAAGGAAGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201517713 Y:14835726-14835748 ATGGAGGAGGAGAGGAAGAAAGG + Intronic
1201543144 Y:15131529-15131551 ATGGAGGGCAAGCAGAAGCAGGG + Intergenic
1201946312 Y:19514658-19514680 ATGGAGGGCAAGCAGAAGCAAGG + Intergenic
1201992626 Y:20043699-20043721 ATGGAGGAGGAGCCAAAGCAGGG - Intergenic