ID: 1198767525

View in Genome Browser
Species Human (GRCh38)
Location X:140094280-140094302
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198767514_1198767525 30 Left 1198767514 X:140094227-140094249 CCTGAAGGATGCACTTTGCAATT No data
Right 1198767525 X:140094280-140094302 CTGAAAAAATATGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198767525 Original CRISPR CTGAAAAAATATGAGGAGGA GGG Intergenic
No off target data available for this crispr