ID: 1198769279

View in Genome Browser
Species Human (GRCh38)
Location X:140111670-140111692
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198769276_1198769279 11 Left 1198769276 X:140111636-140111658 CCGTACAAAAGTAATTACTTCTC No data
Right 1198769279 X:140111670-140111692 AAATATGTGCAGGTTGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198769279 Original CRISPR AAATATGTGCAGGTTGTAGA TGG Intergenic
No off target data available for this crispr