ID: 1198773927

View in Genome Browser
Species Human (GRCh38)
Location X:140159579-140159601
Sequence CTGTAATGATGGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198773921_1198773927 2 Left 1198773921 X:140159554-140159576 CCCTCCACTCGATCTAGGTAGCA No data
Right 1198773927 X:140159579-140159601 CTGTAATGATGGAGGGAAGCTGG No data
1198773922_1198773927 1 Left 1198773922 X:140159555-140159577 CCTCCACTCGATCTAGGTAGCAG No data
Right 1198773927 X:140159579-140159601 CTGTAATGATGGAGGGAAGCTGG No data
1198773923_1198773927 -2 Left 1198773923 X:140159558-140159580 CCACTCGATCTAGGTAGCAGACT No data
Right 1198773927 X:140159579-140159601 CTGTAATGATGGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198773927 Original CRISPR CTGTAATGATGGAGGGAAGC TGG Intergenic
No off target data available for this crispr