ID: 1198774230 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:140162594-140162616 |
| Sequence | TGTCAACTGCTGGATGTGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1198774230_1198774236 | 6 | Left | 1198774230 | X:140162594-140162616 | CCCTCCACATCCAGCAGTTGACA | No data | ||
| Right | 1198774236 | X:140162623-140162645 | GCCTATTCCGCTTCCTATTAGGG | No data | ||||
| 1198774230_1198774240 | 25 | Left | 1198774230 | X:140162594-140162616 | CCCTCCACATCCAGCAGTTGACA | No data | ||
| Right | 1198774240 | X:140162642-140162664 | AGGGAGTCAGCAGAGTAGAGTGG | No data | ||||
| 1198774230_1198774235 | 5 | Left | 1198774230 | X:140162594-140162616 | CCCTCCACATCCAGCAGTTGACA | No data | ||
| Right | 1198774235 | X:140162622-140162644 | TGCCTATTCCGCTTCCTATTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1198774230 | Original CRISPR | TGTCAACTGCTGGATGTGGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||