ID: 1198774230

View in Genome Browser
Species Human (GRCh38)
Location X:140162594-140162616
Sequence TGTCAACTGCTGGATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198774230_1198774236 6 Left 1198774230 X:140162594-140162616 CCCTCCACATCCAGCAGTTGACA No data
Right 1198774236 X:140162623-140162645 GCCTATTCCGCTTCCTATTAGGG No data
1198774230_1198774240 25 Left 1198774230 X:140162594-140162616 CCCTCCACATCCAGCAGTTGACA No data
Right 1198774240 X:140162642-140162664 AGGGAGTCAGCAGAGTAGAGTGG No data
1198774230_1198774235 5 Left 1198774230 X:140162594-140162616 CCCTCCACATCCAGCAGTTGACA No data
Right 1198774235 X:140162622-140162644 TGCCTATTCCGCTTCCTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198774230 Original CRISPR TGTCAACTGCTGGATGTGGA GGG (reversed) Intergenic
No off target data available for this crispr