ID: 1198781502

View in Genome Browser
Species Human (GRCh38)
Location X:140241857-140241879
Sequence GGTCCCAACACAATTACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198781502_1198781504 15 Left 1198781502 X:140241857-140241879 CCAACTGTAATTGTGTTGGGACC No data
Right 1198781504 X:140241895-140241917 TAATATTTGCTTTATGTATCTGG 0: 36
1: 428
2: 766
3: 825
4: 1581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198781502 Original CRISPR GGTCCCAACACAATTACAGT TGG (reversed) Intergenic
No off target data available for this crispr