ID: 1198781504

View in Genome Browser
Species Human (GRCh38)
Location X:140241895-140241917
Sequence TAATATTTGCTTTATGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3636
Summary {0: 36, 1: 428, 2: 766, 3: 825, 4: 1581}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198781502_1198781504 15 Left 1198781502 X:140241857-140241879 CCAACTGTAATTGTGTTGGGACC No data
Right 1198781504 X:140241895-140241917 TAATATTTGCTTTATGTATCTGG 0: 36
1: 428
2: 766
3: 825
4: 1581
1198781503_1198781504 -6 Left 1198781503 X:140241878-140241900 CCTATTTCTAGTTCTAATAATAT No data
Right 1198781504 X:140241895-140241917 TAATATTTGCTTTATGTATCTGG 0: 36
1: 428
2: 766
3: 825
4: 1581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198781504 Original CRISPR TAATATTTGCTTTATGTATC TGG Intergenic
Too many off-targets to display for this crispr