ID: 1198788990

View in Genome Browser
Species Human (GRCh38)
Location X:140322051-140322073
Sequence AGATTGTTATAGCTGTTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198788990_1198788991 25 Left 1198788990 X:140322051-140322073 CCATATAACAGCTATAACAATCT No data
Right 1198788991 X:140322099-140322121 AACCATTCTATCTGATATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198788990 Original CRISPR AGATTGTTATAGCTGTTATA TGG (reversed) Intergenic
No off target data available for this crispr