ID: 1198788990 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:140322051-140322073 |
Sequence | AGATTGTTATAGCTGTTATA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1198788990_1198788991 | 25 | Left | 1198788990 | X:140322051-140322073 | CCATATAACAGCTATAACAATCT | No data | ||
Right | 1198788991 | X:140322099-140322121 | AACCATTCTATCTGATATTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1198788990 | Original CRISPR | AGATTGTTATAGCTGTTATA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |