ID: 1198790233

View in Genome Browser
Species Human (GRCh38)
Location X:140337316-140337338
Sequence TAATCTTTGTCATAGTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198790233_1198790240 27 Left 1198790233 X:140337316-140337338 CCAATAGACTATGACAAAGATTA No data
Right 1198790240 X:140337366-140337388 CCTTATTTGCTGAAGGTGAAGGG No data
1198790233_1198790238 26 Left 1198790233 X:140337316-140337338 CCAATAGACTATGACAAAGATTA No data
Right 1198790238 X:140337365-140337387 ACCTTATTTGCTGAAGGTGAAGG No data
1198790233_1198790237 20 Left 1198790233 X:140337316-140337338 CCAATAGACTATGACAAAGATTA No data
Right 1198790237 X:140337359-140337381 TAGGTTACCTTATTTGCTGAAGG No data
1198790233_1198790234 1 Left 1198790233 X:140337316-140337338 CCAATAGACTATGACAAAGATTA No data
Right 1198790234 X:140337340-140337362 GAAATATCACTCCCATAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198790233 Original CRISPR TAATCTTTGTCATAGTCTAT TGG (reversed) Intergenic
No off target data available for this crispr