ID: 1198790233 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:140337316-140337338 |
| Sequence | TAATCTTTGTCATAGTCTAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1198790233_1198790240 | 27 | Left | 1198790233 | X:140337316-140337338 | CCAATAGACTATGACAAAGATTA | No data | ||
| Right | 1198790240 | X:140337366-140337388 | CCTTATTTGCTGAAGGTGAAGGG | No data | ||||
| 1198790233_1198790238 | 26 | Left | 1198790233 | X:140337316-140337338 | CCAATAGACTATGACAAAGATTA | No data | ||
| Right | 1198790238 | X:140337365-140337387 | ACCTTATTTGCTGAAGGTGAAGG | No data | ||||
| 1198790233_1198790237 | 20 | Left | 1198790233 | X:140337316-140337338 | CCAATAGACTATGACAAAGATTA | No data | ||
| Right | 1198790237 | X:140337359-140337381 | TAGGTTACCTTATTTGCTGAAGG | No data | ||||
| 1198790233_1198790234 | 1 | Left | 1198790233 | X:140337316-140337338 | CCAATAGACTATGACAAAGATTA | No data | ||
| Right | 1198790234 | X:140337340-140337362 | GAAATATCACTCCCATAATTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1198790233 | Original CRISPR | TAATCTTTGTCATAGTCTAT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||