ID: 1198790235

View in Genome Browser
Species Human (GRCh38)
Location X:140337351-140337373
Sequence AAATAAGGTAACCTAATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198790235_1198790240 -8 Left 1198790235 X:140337351-140337373 CCCATAATTAGGTTACCTTATTT No data
Right 1198790240 X:140337366-140337388 CCTTATTTGCTGAAGGTGAAGGG No data
1198790235_1198790238 -9 Left 1198790235 X:140337351-140337373 CCCATAATTAGGTTACCTTATTT No data
Right 1198790238 X:140337365-140337387 ACCTTATTTGCTGAAGGTGAAGG No data
1198790235_1198790241 13 Left 1198790235 X:140337351-140337373 CCCATAATTAGGTTACCTTATTT No data
Right 1198790241 X:140337387-140337409 GGATTTTGCCGATGTAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198790235 Original CRISPR AAATAAGGTAACCTAATTAT GGG (reversed) Intergenic
No off target data available for this crispr