ID: 1198790240

View in Genome Browser
Species Human (GRCh38)
Location X:140337366-140337388
Sequence CCTTATTTGCTGAAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198790235_1198790240 -8 Left 1198790235 X:140337351-140337373 CCCATAATTAGGTTACCTTATTT No data
Right 1198790240 X:140337366-140337388 CCTTATTTGCTGAAGGTGAAGGG No data
1198790236_1198790240 -9 Left 1198790236 X:140337352-140337374 CCATAATTAGGTTACCTTATTTG No data
Right 1198790240 X:140337366-140337388 CCTTATTTGCTGAAGGTGAAGGG No data
1198790233_1198790240 27 Left 1198790233 X:140337316-140337338 CCAATAGACTATGACAAAGATTA No data
Right 1198790240 X:140337366-140337388 CCTTATTTGCTGAAGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198790240 Original CRISPR CCTTATTTGCTGAAGGTGAA GGG Intergenic
No off target data available for this crispr