ID: 1198791786

View in Genome Browser
Species Human (GRCh38)
Location X:140354349-140354371
Sequence CTGTGTCTGTGGGGAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198791786_1198791795 -6 Left 1198791786 X:140354349-140354371 CCCCCCACTCCCCACAGACACAG No data
Right 1198791795 X:140354366-140354388 ACACAGCAGAAGAAAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198791786 Original CRISPR CTGTGTCTGTGGGGAGTGGG GGG (reversed) Intergenic
No off target data available for this crispr