ID: 1198800061

View in Genome Browser
Species Human (GRCh38)
Location X:140439454-140439476
Sequence GAGTCTGAGCCGAGAGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198800061_1198800066 -7 Left 1198800061 X:140439454-140439476 CCCGCGCCTCTCGGCTCAGACTC No data
Right 1198800066 X:140439470-140439492 CAGACTCAGGCCGGCCGTCTCGG No data
1198800061_1198800070 -3 Left 1198800061 X:140439454-140439476 CCCGCGCCTCTCGGCTCAGACTC No data
Right 1198800070 X:140439474-140439496 CTCAGGCCGGCCGTCTCGGGGGG No data
1198800061_1198800068 -5 Left 1198800061 X:140439454-140439476 CCCGCGCCTCTCGGCTCAGACTC No data
Right 1198800068 X:140439472-140439494 GACTCAGGCCGGCCGTCTCGGGG No data
1198800061_1198800074 24 Left 1198800061 X:140439454-140439476 CCCGCGCCTCTCGGCTCAGACTC No data
Right 1198800074 X:140439501-140439523 GCCCAGACCACCGACGCGCCTGG No data
1198800061_1198800071 2 Left 1198800061 X:140439454-140439476 CCCGCGCCTCTCGGCTCAGACTC No data
Right 1198800071 X:140439479-140439501 GCCGGCCGTCTCGGGGGGCGCGG No data
1198800061_1198800078 28 Left 1198800061 X:140439454-140439476 CCCGCGCCTCTCGGCTCAGACTC No data
Right 1198800078 X:140439505-140439527 AGACCACCGACGCGCCTGGCGGG No data
1198800061_1198800079 29 Left 1198800061 X:140439454-140439476 CCCGCGCCTCTCGGCTCAGACTC No data
Right 1198800079 X:140439506-140439528 GACCACCGACGCGCCTGGCGGGG No data
1198800061_1198800069 -4 Left 1198800061 X:140439454-140439476 CCCGCGCCTCTCGGCTCAGACTC No data
Right 1198800069 X:140439473-140439495 ACTCAGGCCGGCCGTCTCGGGGG No data
1198800061_1198800067 -6 Left 1198800061 X:140439454-140439476 CCCGCGCCTCTCGGCTCAGACTC No data
Right 1198800067 X:140439471-140439493 AGACTCAGGCCGGCCGTCTCGGG No data
1198800061_1198800080 30 Left 1198800061 X:140439454-140439476 CCCGCGCCTCTCGGCTCAGACTC No data
Right 1198800080 X:140439507-140439529 ACCACCGACGCGCCTGGCGGGGG No data
1198800061_1198800077 27 Left 1198800061 X:140439454-140439476 CCCGCGCCTCTCGGCTCAGACTC No data
Right 1198800077 X:140439504-140439526 CAGACCACCGACGCGCCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198800061 Original CRISPR GAGTCTGAGCCGAGAGGCGC GGG (reversed) Intergenic
No off target data available for this crispr