ID: 1198800986

View in Genome Browser
Species Human (GRCh38)
Location X:140447414-140447436
Sequence GAGTGGGGCAGAAGCATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198800986_1198800995 3 Left 1198800986 X:140447414-140447436 CCTTCCATGCTTCTGCCCCACTC No data
Right 1198800995 X:140447440-140447462 TGGGTGGAGATTTCAGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198800986 Original CRISPR GAGTGGGGCAGAAGCATGGA AGG (reversed) Intergenic
No off target data available for this crispr