ID: 1198801548

View in Genome Browser
Species Human (GRCh38)
Location X:140452773-140452795
Sequence TTGGAGATACAGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198801541_1198801548 6 Left 1198801541 X:140452744-140452766 CCAGTTTTCCAGTTTGTGTCCTG No data
Right 1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG No data
1198801542_1198801548 -2 Left 1198801542 X:140452752-140452774 CCAGTTTGTGTCCTGCCAGAATT No data
Right 1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198801548 Original CRISPR TTGGAGATACAGAAGGAGCA GGG Intergenic
No off target data available for this crispr