ID: 1198805018

View in Genome Browser
Species Human (GRCh38)
Location X:140485459-140485481
Sequence CTAAACATGGAAAATTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198805013_1198805018 11 Left 1198805013 X:140485425-140485447 CCAGCCTGACCAACATGGAGAAA 0: 18586
1: 36319
2: 134688
3: 174060
4: 144372
Right 1198805018 X:140485459-140485481 CTAAACATGGAAAATTAGTCAGG No data
1198805015_1198805018 2 Left 1198805015 X:140485434-140485456 CCAACATGGAGAAACCTCATCTC 0: 390
1: 11708
2: 67670
3: 120217
4: 130976
Right 1198805018 X:140485459-140485481 CTAAACATGGAAAATTAGTCAGG No data
1198805014_1198805018 7 Left 1198805014 X:140485429-140485451 CCTGACCAACATGGAGAAACCTC 0: 789
1: 14624
2: 39240
3: 122733
4: 186006
Right 1198805018 X:140485459-140485481 CTAAACATGGAAAATTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198805018 Original CRISPR CTAAACATGGAAAATTAGTC AGG Intergenic
No off target data available for this crispr