ID: 1198806920

View in Genome Browser
Species Human (GRCh38)
Location X:140502633-140502655
Sequence CTTTCCAGCCCCGCCTCGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198806916_1198806920 6 Left 1198806916 X:140502604-140502626 CCGTTTTTGGTCGGTTTCAGCGG No data
Right 1198806920 X:140502633-140502655 CTTTCCAGCCCCGCCTCGCGTGG No data
1198806915_1198806920 7 Left 1198806915 X:140502603-140502625 CCCGTTTTTGGTCGGTTTCAGCG No data
Right 1198806920 X:140502633-140502655 CTTTCCAGCCCCGCCTCGCGTGG No data
1198806914_1198806920 8 Left 1198806914 X:140502602-140502624 CCCCGTTTTTGGTCGGTTTCAGC No data
Right 1198806920 X:140502633-140502655 CTTTCCAGCCCCGCCTCGCGTGG No data
1198806911_1198806920 30 Left 1198806911 X:140502580-140502602 CCAGTGCACAAAGGTAAAAGTGC No data
Right 1198806920 X:140502633-140502655 CTTTCCAGCCCCGCCTCGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198806920 Original CRISPR CTTTCCAGCCCCGCCTCGCG TGG Intergenic