ID: 1198807288

View in Genome Browser
Species Human (GRCh38)
Location X:140504699-140504721
Sequence GCCGGCGGCGCGAACTCGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198807288_1198807298 19 Left 1198807288 X:140504699-140504721 CCGCCCGAGTTCGCGCCGCCGGC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1198807298 X:140504741-140504763 CCTGCGCCTCCCGGGGCTGCGGG 0: 1
1: 0
2: 4
3: 70
4: 507
1198807288_1198807296 18 Left 1198807288 X:140504699-140504721 CCGCCCGAGTTCGCGCCGCCGGC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1198807296 X:140504740-140504762 GCCTGCGCCTCCCGGGGCTGCGG 0: 1
1: 0
2: 3
3: 52
4: 574
1198807288_1198807294 11 Left 1198807288 X:140504699-140504721 CCGCCCGAGTTCGCGCCGCCGGC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1198807294 X:140504733-140504755 TACTCTTGCCTGCGCCTCCCGGG 0: 1
1: 0
2: 5
3: 339
4: 6015
1198807288_1198807301 27 Left 1198807288 X:140504699-140504721 CCGCCCGAGTTCGCGCCGCCGGC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1198807301 X:140504749-140504771 TCCCGGGGCTGCGGGGCCGCCGG 0: 1
1: 0
2: 10
3: 56
4: 491
1198807288_1198807295 12 Left 1198807288 X:140504699-140504721 CCGCCCGAGTTCGCGCCGCCGGC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1198807295 X:140504734-140504756 ACTCTTGCCTGCGCCTCCCGGGG 0: 1
1: 0
2: 1
3: 49
4: 1250
1198807288_1198807299 20 Left 1198807288 X:140504699-140504721 CCGCCCGAGTTCGCGCCGCCGGC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1198807299 X:140504742-140504764 CTGCGCCTCCCGGGGCTGCGGGG 0: 1
1: 1
2: 3
3: 27
4: 292
1198807288_1198807293 10 Left 1198807288 X:140504699-140504721 CCGCCCGAGTTCGCGCCGCCGGC 0: 1
1: 0
2: 0
3: 9
4: 79
Right 1198807293 X:140504732-140504754 CTACTCTTGCCTGCGCCTCCCGG 0: 1
1: 0
2: 1
3: 20
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198807288 Original CRISPR GCCGGCGGCGCGAACTCGGG CGG (reversed) Exonic
904500151 1:30908587-30908609 GGCGGCGGCGCGGGCGCGGGCGG + Exonic
908555584 1:65254297-65254319 GCCCGCGCCGCTCACTCGGGGGG - Intronic
910968651 1:92832285-92832307 GCCCGGTGCGCGAACTTGGGGGG + Intronic
911144815 1:94541846-94541868 GCCGGGGGCGGGGAGTCGGGAGG - Intergenic
913109151 1:115642189-115642211 TCCGGCGGGGCGAATGCGGGAGG - Intronic
1062843780 10:689674-689696 GGCGGCGGCGCGGGCGCGGGAGG + Intronic
1068690149 10:59906282-59906304 GGCGGCGGTGGGAAGTCGGGGGG - Exonic
1069438505 10:68407196-68407218 GGCGGCTGCGCGGTCTCGGGCGG + Intronic
1073135210 10:101216399-101216421 GCGGGCGGCGCGGCCTCGCGCGG + Intergenic
1075999824 10:126905681-126905703 GGCGGCGGCGCGGGCGCGGGCGG - Intronic
1091550105 12:1530462-1530484 GCCCGAGGCGCGGGCTCGGGAGG - Intronic
1099989763 12:89709312-89709334 GGCGGCGGCGCGAGCTTCGGCGG - Intergenic
1101150224 12:101877213-101877235 GCCGGCGGCGGGACCTCGGAGGG + Intergenic
1104987173 12:132603742-132603764 GCCAGCGGCGCAAACGCGGTGGG - Intronic
1117156820 14:52950635-52950657 GCCGGCGCTGCGAATTCGGTGGG - Intronic
1117478255 14:56118583-56118605 AGCGGCGGCGCGGACTCGGCGGG + Exonic
1118971489 14:70641877-70641899 GCGGGCGGCGCGGAGCCGGGAGG + Exonic
1121803858 14:96797492-96797514 GCCGGGGGCGCGGAGGCGGGCGG + Intronic
1123165215 14:106319623-106319645 GCAGGCTGCGCCAACTCGGTGGG - Intergenic
1127142725 15:55993744-55993766 GCCGGCGGCGCGCGCTCCTGGGG + Intronic
1129406498 15:75322622-75322644 GCCGGCGGCGCGGTCCTGGGTGG + Intergenic
1130390184 15:83447844-83447866 GGCGGCCGCGGGGACTCGGGAGG + Intronic
1138360808 16:56425619-56425641 GGCGGCGGCGCGACCGCTGGGGG - Intergenic
1140221483 16:73047716-73047738 GCCGGCTGCGCGGACCCGGAGGG + Intronic
1142859041 17:2749756-2749778 GCCGGCGGCGCGCGGTCGGGGGG + Intergenic
1144340770 17:14309155-14309177 GCCGGGGGCGCTACCACGGGCGG + Intronic
1147331194 17:39700368-39700390 GCCGGCCGCGGGACCTCGGCGGG - Intronic
1148945862 17:51260946-51260968 GCGGGCTGGGCGCACTCGGGCGG + Intronic
1153285151 18:3449992-3450014 GGCGGCGGTGCGGACGCGGGGGG - Intronic
1157353996 18:46917131-46917153 GCCGGCGGAGGGCACGCGGGCGG - Intronic
1162911577 19:13850626-13850648 GCCGGCGGCCCGATCTCGGCTGG + Intergenic
1166363536 19:42267005-42267027 GCCTGAGGCGTGAACCCGGGAGG + Intergenic
1166375229 19:42324069-42324091 GCGCGCGGGGCGAACTCCGGCGG - Intronic
1167578500 19:50328982-50329004 GGCGGCGGCGGGGACTCGGGCGG + Exonic
925609794 2:5693154-5693176 GGCGGCGGCGGGAGCGCGGGCGG + Exonic
926285159 2:11482546-11482568 GCCCGGGGCGCGAACCCGGGTGG + Intergenic
927156296 2:20223605-20223627 GCTGGGGAGGCGAACTCGGGCGG + Intronic
927772840 2:25878522-25878544 GCCGGCCGCGCGAACGAGCGCGG + Intergenic
931994285 2:67824792-67824814 GCCGGAGGCGGGAAATCCGGGGG - Intergenic
932347007 2:71002059-71002081 GCCTGCGGCCCCAACTCAGGTGG + Intergenic
932772331 2:74507521-74507543 GCCAGCGGTGCGAATTGGGGCGG - Intronic
934105555 2:88691762-88691784 GCCGGGGGCGCGGCCTCCGGCGG + Exonic
943589867 2:189784272-189784294 GCCGGCGGCCCGGAGTGGGGCGG - Intronic
944811072 2:203328218-203328240 GCCGGCGGCGCGGGCGAGGGTGG + Exonic
944811118 2:203328394-203328416 GACGGCGGCGGTAACTCGGAAGG - Exonic
949004303 2:241636854-241636876 GCGGCCGGCCCGAACGCGGGGGG - Intronic
1172742404 20:37179319-37179341 GCCCGCGGCTCGGACTCCGGCGG + Exonic
1173849766 20:46210400-46210422 GAGGGCGGCCGGAACTCGGGGGG + Exonic
1175526100 20:59634782-59634804 GCCAGCGGCGCAATCCCGGGCGG - Intronic
1179810240 21:43865362-43865384 GGGGGCGGCCCGACCTCGGGTGG - Intronic
1179988196 21:44932581-44932603 CCCGGCGGGGCGGCCTCGGGAGG + Intergenic
1180559047 22:16601355-16601377 GGCGGCGGCGCGTCCGCGGGCGG + Intergenic
953561207 3:43995221-43995243 GCCGGGGGCGCGCACACGAGGGG + Intergenic
954664691 3:52245686-52245708 GCCGGGGGCGCGCAGACGGGAGG - Intergenic
955972045 3:64445592-64445614 GACCGCGGGGCGAACCCGGGAGG - Intergenic
961666875 3:128498019-128498041 GGCGGCGGCGGGGTCTCGGGTGG + Intergenic
966696392 3:182793860-182793882 GCCGGCGGCGCGGAGCCGGGAGG + Intronic
968434105 4:576186-576208 GGCGGCGGCGCGGGCCCGGGAGG - Intergenic
972112285 4:35578953-35578975 AATGGCGGCGTGAACTCGGGAGG - Intergenic
978741761 4:112145441-112145463 GCCGGCGGGGCGCGCTCCGGCGG + Exonic
984155882 4:176195615-176195637 GCTGGCGGCGCGGTCTCGTGGGG + Exonic
985660859 5:1155918-1155940 GCCGGCGGGGCGGGCGCGGGAGG + Intergenic
985995715 5:3595966-3595988 GCCGGCCGGGCGCGCTCGGGCGG - Intergenic
991216886 5:64165960-64165982 GCCGGCGGGTCGGAGTCGGGCGG + Intronic
996738345 5:126777181-126777203 GGCGGCGGCGCGAACCCTGCTGG + Exonic
1002670297 5:180861180-180861202 GCCGGGGGCGGGAGCGCGGGCGG + Intronic
1003942680 6:11044386-11044408 GGCGGCGGCGCGAGCCCGAGGGG - Intergenic
1008030333 6:46687888-46687910 CCCGGAAGCGCGACCTCGGGCGG + Intronic
1017810754 6:157981900-157981922 GCGGGCAGCGCGCCCTCGGGAGG + Exonic
1021868256 7:24979814-24979836 GGCGGCGGCGCGGGCTCGGAAGG - Intronic
1025296187 7:57776710-57776732 GGCGGCTGCGGGGACTCGGGCGG - Intergenic
1027400349 7:77799415-77799437 GCCGGAGGAGCGGGCTCGGGAGG + Intronic
1028477045 7:91264660-91264682 GGCGGCGGGGAGAACCCGGGTGG - Exonic
1029123118 7:98281518-98281540 GCCGGCGGGGCGGCTTCGGGAGG + Intronic
1032125215 7:129188677-129188699 GCCGGCGGGGAGAGTTCGGGGGG + Intergenic
1032240374 7:130154708-130154730 GCAGGCGGCGCGAAGCCAGGCGG - Intergenic
1034262303 7:149764727-149764749 GGGGGCGGCGCCACCTCGGGGGG + Exonic
1034618272 7:152436652-152436674 GGCGGCGGCGCGTCCGCGGGCGG - Intergenic
1041505866 8:58596839-58596861 AACGGCGGCGTGAACCCGGGAGG + Intronic
1042903020 8:73746935-73746957 GCGCGCGGCGCGAGCGCGGGAGG - Exonic
1049834310 8:144724170-144724192 GGAGGCGGAGCGAACCCGGGAGG + Intronic
1056386285 9:86099595-86099617 GCCGGCGGCGCGAAGGGAGGAGG + Intronic
1057772840 9:97983421-97983443 GCCGGCGGCGCGGTCCTGGGTGG - Exonic
1062306180 9:135908021-135908043 GCCGGCGGCGAGACCTCGGCCGG - Intergenic
1062558870 9:137130214-137130236 GCCGGGTCCGCGACCTCGGGAGG - Intergenic
1198807288 X:140504699-140504721 GCCGGCGGCGCGAACTCGGGCGG - Exonic
1200231027 X:154443987-154444009 GCCGGCGGCGGGGGCTGGGGCGG + Intergenic
1200821908 Y:7594563-7594585 GACAGTGGCGCGAACTCGGGAGG - Intergenic
1202238395 Y:22739453-22739475 GACAGTGGCGCGAACTCGGGAGG + Intergenic