ID: 1198811785

View in Genome Browser
Species Human (GRCh38)
Location X:140543373-140543395
Sequence TCACCATCCTGGGCTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198811785_1198811791 -6 Left 1198811785 X:140543373-140543395 CCAGTTTTAGCCCAGGATGGTGA No data
Right 1198811791 X:140543390-140543412 TGGTGAGTAGATGGGTAAATGGG No data
1198811785_1198811790 -7 Left 1198811785 X:140543373-140543395 CCAGTTTTAGCCCAGGATGGTGA No data
Right 1198811790 X:140543389-140543411 ATGGTGAGTAGATGGGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198811785 Original CRISPR TCACCATCCTGGGCTAAAAC TGG (reversed) Intergenic
No off target data available for this crispr