ID: 1198816748

View in Genome Browser
Species Human (GRCh38)
Location X:140599657-140599679
Sequence GCCTACACCACAAATAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198816748_1198816754 29 Left 1198816748 X:140599657-140599679 CCTACTCTATTTGTGGTGTAGGC No data
Right 1198816754 X:140599709-140599731 AGCATCTCTGGTATGCAACCTGG No data
1198816748_1198816753 17 Left 1198816748 X:140599657-140599679 CCTACTCTATTTGTGGTGTAGGC No data
Right 1198816753 X:140599697-140599719 ATCAGGTCTGGTAGCATCTCTGG No data
1198816748_1198816752 5 Left 1198816748 X:140599657-140599679 CCTACTCTATTTGTGGTGTAGGC No data
Right 1198816752 X:140599685-140599707 AATCTGGACTACATCAGGTCTGG No data
1198816748_1198816751 0 Left 1198816748 X:140599657-140599679 CCTACTCTATTTGTGGTGTAGGC No data
Right 1198816751 X:140599680-140599702 TGGCTAATCTGGACTACATCAGG No data
1198816748_1198816755 30 Left 1198816748 X:140599657-140599679 CCTACTCTATTTGTGGTGTAGGC No data
Right 1198816755 X:140599710-140599732 GCATCTCTGGTATGCAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198816748 Original CRISPR GCCTACACCACAAATAGAGT AGG (reversed) Intergenic
No off target data available for this crispr