ID: 1198820660

View in Genome Browser
Species Human (GRCh38)
Location X:140644747-140644769
Sequence CCATATGTATGATGGGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198820651_1198820660 -3 Left 1198820651 X:140644727-140644749 CCTCCCTGAACCTCAGTTTCCCA No data
Right 1198820660 X:140644747-140644769 CCATATGTATGATGGGGCAGTGG No data
1198820650_1198820660 24 Left 1198820650 X:140644700-140644722 CCACTGGATGAGGCATTAACTAC No data
Right 1198820660 X:140644747-140644769 CCATATGTATGATGGGGCAGTGG No data
1198820653_1198820660 -7 Left 1198820653 X:140644731-140644753 CCTGAACCTCAGTTTCCCATATG No data
Right 1198820660 X:140644747-140644769 CCATATGTATGATGGGGCAGTGG No data
1198820652_1198820660 -6 Left 1198820652 X:140644730-140644752 CCCTGAACCTCAGTTTCCCATAT No data
Right 1198820660 X:140644747-140644769 CCATATGTATGATGGGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198820660 Original CRISPR CCATATGTATGATGGGGCAG TGG Intergenic
No off target data available for this crispr