ID: 1198830378

View in Genome Browser
Species Human (GRCh38)
Location X:140744178-140744200
Sequence GCCAACTTCTGATCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198830375_1198830378 15 Left 1198830375 X:140744140-140744162 CCACAAGGGCTGCAAACCTGGCA No data
Right 1198830378 X:140744178-140744200 GCCAACTTCTGATCTGTTACTGG No data
1198830377_1198830378 -10 Left 1198830377 X:140744165-140744187 CCAATAGCAAAGAGCCAACTTCT No data
Right 1198830378 X:140744178-140744200 GCCAACTTCTGATCTGTTACTGG No data
1198830376_1198830378 -1 Left 1198830376 X:140744156-140744178 CCTGGCAAACCAATAGCAAAGAG No data
Right 1198830378 X:140744178-140744200 GCCAACTTCTGATCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198830378 Original CRISPR GCCAACTTCTGATCTGTTAC TGG Intergenic
No off target data available for this crispr