ID: 1198831074

View in Genome Browser
Species Human (GRCh38)
Location X:140751311-140751333
Sequence CCACCTTACTTGTGCAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198831074_1198831077 -10 Left 1198831074 X:140751311-140751333 CCATTTTTGCACAAGTAAGGTGG No data
Right 1198831077 X:140751324-140751346 AGTAAGGTGGTATTTCATGGTGG No data
1198831074_1198831078 18 Left 1198831074 X:140751311-140751333 CCATTTTTGCACAAGTAAGGTGG No data
Right 1198831078 X:140751352-140751374 ATTTGCATTTCCCTGATAATTGG 0: 20
1: 72
2: 247
3: 517
4: 918

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198831074 Original CRISPR CCACCTTACTTGTGCAAAAA TGG (reversed) Intergenic
No off target data available for this crispr