ID: 1198831230

View in Genome Browser
Species Human (GRCh38)
Location X:140752837-140752859
Sequence AAGGGCCGAATTAACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198831230_1198831235 12 Left 1198831230 X:140752837-140752859 CCTCCTGAGTTAATTCGGCCCTT No data
Right 1198831235 X:140752872-140752894 GCTTAGTGTGCTGAAATTGATGG No data
1198831230_1198831237 21 Left 1198831230 X:140752837-140752859 CCTCCTGAGTTAATTCGGCCCTT No data
Right 1198831237 X:140752881-140752903 GCTGAAATTGATGGTTGAGGAGG No data
1198831230_1198831236 18 Left 1198831230 X:140752837-140752859 CCTCCTGAGTTAATTCGGCCCTT No data
Right 1198831236 X:140752878-140752900 TGTGCTGAAATTGATGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198831230 Original CRISPR AAGGGCCGAATTAACTCAGG AGG (reversed) Intergenic
No off target data available for this crispr