ID: 1198833484

View in Genome Browser
Species Human (GRCh38)
Location X:140776541-140776563
Sequence CGCGCGTGACCACCCACTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198833477_1198833484 0 Left 1198833477 X:140776518-140776540 CCGGGGTCCTCGTTACCCAAGCC No data
Right 1198833484 X:140776541-140776563 CGCGCGTGACCACCCACTCCGGG No data
1198833464_1198833484 29 Left 1198833464 X:140776489-140776511 CCCTCTTCCTTCCTTCCTCCCGC No data
Right 1198833484 X:140776541-140776563 CGCGCGTGACCACCCACTCCGGG No data
1198833466_1198833484 22 Left 1198833466 X:140776496-140776518 CCTTCCTTCCTCCCGCCACCCGC No data
Right 1198833484 X:140776541-140776563 CGCGCGTGACCACCCACTCCGGG No data
1198833465_1198833484 28 Left 1198833465 X:140776490-140776512 CCTCTTCCTTCCTTCCTCCCGCC No data
Right 1198833484 X:140776541-140776563 CGCGCGTGACCACCCACTCCGGG No data
1198833475_1198833484 4 Left 1198833475 X:140776514-140776536 CCCGCCGGGGTCCTCGTTACCCA No data
Right 1198833484 X:140776541-140776563 CGCGCGTGACCACCCACTCCGGG No data
1198833474_1198833484 7 Left 1198833474 X:140776511-140776533 CCACCCGCCGGGGTCCTCGTTAC No data
Right 1198833484 X:140776541-140776563 CGCGCGTGACCACCCACTCCGGG No data
1198833476_1198833484 3 Left 1198833476 X:140776515-140776537 CCGCCGGGGTCCTCGTTACCCAA No data
Right 1198833484 X:140776541-140776563 CGCGCGTGACCACCCACTCCGGG No data
1198833468_1198833484 18 Left 1198833468 X:140776500-140776522 CCTTCCTCCCGCCACCCGCCGGG No data
Right 1198833484 X:140776541-140776563 CGCGCGTGACCACCCACTCCGGG No data
1198833471_1198833484 14 Left 1198833471 X:140776504-140776526 CCTCCCGCCACCCGCCGGGGTCC No data
Right 1198833484 X:140776541-140776563 CGCGCGTGACCACCCACTCCGGG No data
1198833478_1198833484 -7 Left 1198833478 X:140776525-140776547 CCTCGTTACCCAAGCCCGCGCGT No data
Right 1198833484 X:140776541-140776563 CGCGCGTGACCACCCACTCCGGG No data
1198833473_1198833484 10 Left 1198833473 X:140776508-140776530 CCGCCACCCGCCGGGGTCCTCGT No data
Right 1198833484 X:140776541-140776563 CGCGCGTGACCACCCACTCCGGG No data
1198833472_1198833484 11 Left 1198833472 X:140776507-140776529 CCCGCCACCCGCCGGGGTCCTCG No data
Right 1198833484 X:140776541-140776563 CGCGCGTGACCACCCACTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198833484 Original CRISPR CGCGCGTGACCACCCACTCC GGG Intergenic
No off target data available for this crispr