ID: 1198836968

View in Genome Browser
Species Human (GRCh38)
Location X:140815861-140815883
Sequence TAGGGTAATGTTCTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198836959_1198836968 9 Left 1198836959 X:140815829-140815851 CCTGTGAAGGATGGGGGTGGTTC No data
Right 1198836968 X:140815861-140815883 TAGGGTAATGTTCTGGAGGAAGG No data
1198836958_1198836968 10 Left 1198836958 X:140815828-140815850 CCCTGTGAAGGATGGGGGTGGTT No data
Right 1198836968 X:140815861-140815883 TAGGGTAATGTTCTGGAGGAAGG No data
1198836957_1198836968 11 Left 1198836957 X:140815827-140815849 CCCCTGTGAAGGATGGGGGTGGT No data
Right 1198836968 X:140815861-140815883 TAGGGTAATGTTCTGGAGGAAGG No data
1198836952_1198836968 17 Left 1198836952 X:140815821-140815843 CCACAGCCCCTGTGAAGGATGGG No data
Right 1198836968 X:140815861-140815883 TAGGGTAATGTTCTGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198836968 Original CRISPR TAGGGTAATGTTCTGGAGGA AGG Intergenic
No off target data available for this crispr