ID: 1198840234

View in Genome Browser
Species Human (GRCh38)
Location X:140848651-140848673
Sequence AGTTACCTACACCAGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198840234_1198840241 24 Left 1198840234 X:140848651-140848673 CCAGCCATCTGGTGTAGGTAACT No data
Right 1198840241 X:140848698-140848720 CAGATAAAAAACAAAGAAGGAGG No data
1198840234_1198840238 21 Left 1198840234 X:140848651-140848673 CCAGCCATCTGGTGTAGGTAACT No data
Right 1198840238 X:140848695-140848717 ACCCAGATAAAAAACAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198840234 Original CRISPR AGTTACCTACACCAGATGGC TGG (reversed) Intergenic
No off target data available for this crispr