ID: 1198845904

View in Genome Browser
Species Human (GRCh38)
Location X:140910187-140910209
Sequence CTGGAGATTCAGATGAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198845904_1198845908 13 Left 1198845904 X:140910187-140910209 CCAACTCTCATCTGAATCTCCAG No data
Right 1198845908 X:140910223-140910245 AGAACACTGACTAATAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198845904 Original CRISPR CTGGAGATTCAGATGAGAGT TGG (reversed) Intergenic
No off target data available for this crispr