ID: 1198848153

View in Genome Browser
Species Human (GRCh38)
Location X:140935960-140935982
Sequence CTGGAGACCCAGGGAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198848147_1198848153 1 Left 1198848147 X:140935936-140935958 CCAAAATCTGAAGTCACCAGTAG No data
Right 1198848153 X:140935960-140935982 CTGGAGACCCAGGGAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198848153 Original CRISPR CTGGAGACCCAGGGAAGAAC TGG Intergenic
No off target data available for this crispr