ID: 1198860807

View in Genome Browser
Species Human (GRCh38)
Location X:141067979-141068001
Sequence GTGTTGATATAAAGCCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198860804_1198860807 10 Left 1198860804 X:141067946-141067968 CCCTACAGACACAGCAGCTCTAT No data
Right 1198860807 X:141067979-141068001 GTGTTGATATAAAGCCATCCAGG No data
1198860805_1198860807 9 Left 1198860805 X:141067947-141067969 CCTACAGACACAGCAGCTCTATG No data
Right 1198860807 X:141067979-141068001 GTGTTGATATAAAGCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198860807 Original CRISPR GTGTTGATATAAAGCCATCC AGG Intergenic
No off target data available for this crispr