ID: 1198862326

View in Genome Browser
Species Human (GRCh38)
Location X:141084345-141084367
Sequence CGGCGTTCAGCGGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198862326_1198862336 23 Left 1198862326 X:141084345-141084367 CCGTCCACCACCGCTGAACGCCG No data
Right 1198862336 X:141084391-141084413 TCCACTCCTCCAGATCCAGCAGG No data
1198862326_1198862338 24 Left 1198862326 X:141084345-141084367 CCGTCCACCACCGCTGAACGCCG No data
Right 1198862338 X:141084392-141084414 CCACTCCTCCAGATCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198862326 Original CRISPR CGGCGTTCAGCGGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr