ID: 1198882310

View in Genome Browser
Species Human (GRCh38)
Location X:141294879-141294901
Sequence CTCTGTGTATGGGGGTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198882310_1198882320 4 Left 1198882310 X:141294879-141294901 CCAGCTGACCCCCATACACAGAG No data
Right 1198882320 X:141294906-141294928 CATTAAATCCCCTGGCCGGAGGG No data
1198882310_1198882324 13 Left 1198882310 X:141294879-141294901 CCAGCTGACCCCCATACACAGAG No data
Right 1198882324 X:141294915-141294937 CCCTGGCCGGAGGGGAATCACGG No data
1198882310_1198882319 3 Left 1198882310 X:141294879-141294901 CCAGCTGACCCCCATACACAGAG No data
Right 1198882319 X:141294905-141294927 GCATTAAATCCCCTGGCCGGAGG No data
1198882310_1198882317 -4 Left 1198882310 X:141294879-141294901 CCAGCTGACCCCCATACACAGAG No data
Right 1198882317 X:141294898-141294920 AGAGGGAGCATTAAATCCCCTGG No data
1198882310_1198882318 0 Left 1198882310 X:141294879-141294901 CCAGCTGACCCCCATACACAGAG No data
Right 1198882318 X:141294902-141294924 GGAGCATTAAATCCCCTGGCCGG No data
1198882310_1198882321 5 Left 1198882310 X:141294879-141294901 CCAGCTGACCCCCATACACAGAG No data
Right 1198882321 X:141294907-141294929 ATTAAATCCCCTGGCCGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198882310 Original CRISPR CTCTGTGTATGGGGGTCAGC TGG (reversed) Intergenic
No off target data available for this crispr