ID: 1198883496

View in Genome Browser
Species Human (GRCh38)
Location X:141307079-141307101
Sequence GCAACAACGCAGTAAGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198883492_1198883496 23 Left 1198883492 X:141307033-141307055 CCATTAGTTTTAGCGAACACTGA No data
Right 1198883496 X:141307079-141307101 GCAACAACGCAGTAAGTACCTGG No data
1198883495_1198883496 -5 Left 1198883495 X:141307061-141307083 CCAAAATCAGAGAGAGGCGCAAC No data
Right 1198883496 X:141307079-141307101 GCAACAACGCAGTAAGTACCTGG No data
1198883494_1198883496 -2 Left 1198883494 X:141307058-141307080 CCACCAAAATCAGAGAGAGGCGC No data
Right 1198883496 X:141307079-141307101 GCAACAACGCAGTAAGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198883496 Original CRISPR GCAACAACGCAGTAAGTACC TGG Intergenic