ID: 1198887266

View in Genome Browser
Species Human (GRCh38)
Location X:141353322-141353344
Sequence TTACTCCTGGATTGTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198887266_1198887269 -7 Left 1198887266 X:141353322-141353344 CCAGCAGCACAATCCAGGAGTAA No data
Right 1198887269 X:141353338-141353360 GGAGTAATTGGTCCTTGATCAGG No data
1198887266_1198887276 23 Left 1198887266 X:141353322-141353344 CCAGCAGCACAATCCAGGAGTAA No data
Right 1198887276 X:141353368-141353390 GGCTGGCCGTGTTTACCACTTGG No data
1198887266_1198887277 24 Left 1198887266 X:141353322-141353344 CCAGCAGCACAATCCAGGAGTAA No data
Right 1198887277 X:141353369-141353391 GCTGGCCGTGTTTACCACTTGGG No data
1198887266_1198887271 -1 Left 1198887266 X:141353322-141353344 CCAGCAGCACAATCCAGGAGTAA No data
Right 1198887271 X:141353344-141353366 ATTGGTCCTTGATCAGGGCCAGG No data
1198887266_1198887274 6 Left 1198887266 X:141353322-141353344 CCAGCAGCACAATCCAGGAGTAA No data
Right 1198887274 X:141353351-141353373 CTTGATCAGGGCCAGGAGGCTGG No data
1198887266_1198887272 2 Left 1198887266 X:141353322-141353344 CCAGCAGCACAATCCAGGAGTAA No data
Right 1198887272 X:141353347-141353369 GGTCCTTGATCAGGGCCAGGAGG No data
1198887266_1198887270 -6 Left 1198887266 X:141353322-141353344 CCAGCAGCACAATCCAGGAGTAA No data
Right 1198887270 X:141353339-141353361 GAGTAATTGGTCCTTGATCAGGG No data
1198887266_1198887281 30 Left 1198887266 X:141353322-141353344 CCAGCAGCACAATCCAGGAGTAA No data
Right 1198887281 X:141353375-141353397 CGTGTTTACCACTTGGGGCAGGG No data
1198887266_1198887280 29 Left 1198887266 X:141353322-141353344 CCAGCAGCACAATCCAGGAGTAA No data
Right 1198887280 X:141353374-141353396 CCGTGTTTACCACTTGGGGCAGG No data
1198887266_1198887278 25 Left 1198887266 X:141353322-141353344 CCAGCAGCACAATCCAGGAGTAA No data
Right 1198887278 X:141353370-141353392 CTGGCCGTGTTTACCACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198887266 Original CRISPR TTACTCCTGGATTGTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr