ID: 1198887268

View in Genome Browser
Species Human (GRCh38)
Location X:141353335-141353357
Sequence GATCAAGGACCAATTACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198887268_1198887274 -7 Left 1198887268 X:141353335-141353357 CCAGGAGTAATTGGTCCTTGATC No data
Right 1198887274 X:141353351-141353373 CTTGATCAGGGCCAGGAGGCTGG No data
1198887268_1198887277 11 Left 1198887268 X:141353335-141353357 CCAGGAGTAATTGGTCCTTGATC No data
Right 1198887277 X:141353369-141353391 GCTGGCCGTGTTTACCACTTGGG No data
1198887268_1198887276 10 Left 1198887268 X:141353335-141353357 CCAGGAGTAATTGGTCCTTGATC No data
Right 1198887276 X:141353368-141353390 GGCTGGCCGTGTTTACCACTTGG No data
1198887268_1198887280 16 Left 1198887268 X:141353335-141353357 CCAGGAGTAATTGGTCCTTGATC No data
Right 1198887280 X:141353374-141353396 CCGTGTTTACCACTTGGGGCAGG No data
1198887268_1198887282 18 Left 1198887268 X:141353335-141353357 CCAGGAGTAATTGGTCCTTGATC No data
Right 1198887282 X:141353376-141353398 GTGTTTACCACTTGGGGCAGGGG No data
1198887268_1198887281 17 Left 1198887268 X:141353335-141353357 CCAGGAGTAATTGGTCCTTGATC No data
Right 1198887281 X:141353375-141353397 CGTGTTTACCACTTGGGGCAGGG No data
1198887268_1198887278 12 Left 1198887268 X:141353335-141353357 CCAGGAGTAATTGGTCCTTGATC No data
Right 1198887278 X:141353370-141353392 CTGGCCGTGTTTACCACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198887268 Original CRISPR GATCAAGGACCAATTACTCC TGG (reversed) Intergenic
No off target data available for this crispr