ID: 1198887273

View in Genome Browser
Species Human (GRCh38)
Location X:141353350-141353372
Sequence CAGCCTCCTGGCCCTGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198887273_1198887278 -3 Left 1198887273 X:141353350-141353372 CCTTGATCAGGGCCAGGAGGCTG No data
Right 1198887278 X:141353370-141353392 CTGGCCGTGTTTACCACTTGGGG No data
1198887273_1198887277 -4 Left 1198887273 X:141353350-141353372 CCTTGATCAGGGCCAGGAGGCTG No data
Right 1198887277 X:141353369-141353391 GCTGGCCGTGTTTACCACTTGGG No data
1198887273_1198887282 3 Left 1198887273 X:141353350-141353372 CCTTGATCAGGGCCAGGAGGCTG No data
Right 1198887282 X:141353376-141353398 GTGTTTACCACTTGGGGCAGGGG No data
1198887273_1198887285 25 Left 1198887273 X:141353350-141353372 CCTTGATCAGGGCCAGGAGGCTG No data
Right 1198887285 X:141353398-141353420 GCATTCATAGCCCTTGGTTTCGG No data
1198887273_1198887281 2 Left 1198887273 X:141353350-141353372 CCTTGATCAGGGCCAGGAGGCTG No data
Right 1198887281 X:141353375-141353397 CGTGTTTACCACTTGGGGCAGGG No data
1198887273_1198887284 19 Left 1198887273 X:141353350-141353372 CCTTGATCAGGGCCAGGAGGCTG No data
Right 1198887284 X:141353392-141353414 GCAGGGGCATTCATAGCCCTTGG No data
1198887273_1198887276 -5 Left 1198887273 X:141353350-141353372 CCTTGATCAGGGCCAGGAGGCTG No data
Right 1198887276 X:141353368-141353390 GGCTGGCCGTGTTTACCACTTGG No data
1198887273_1198887280 1 Left 1198887273 X:141353350-141353372 CCTTGATCAGGGCCAGGAGGCTG No data
Right 1198887280 X:141353374-141353396 CCGTGTTTACCACTTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198887273 Original CRISPR CAGCCTCCTGGCCCTGATCA AGG (reversed) Intergenic
No off target data available for this crispr