ID: 1198887275

View in Genome Browser
Species Human (GRCh38)
Location X:141353362-141353384
Sequence GGTAAACACGGCCAGCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198887275_1198887285 13 Left 1198887275 X:141353362-141353384 CCAGGAGGCTGGCCGTGTTTACC No data
Right 1198887285 X:141353398-141353420 GCATTCATAGCCCTTGGTTTCGG No data
1198887275_1198887284 7 Left 1198887275 X:141353362-141353384 CCAGGAGGCTGGCCGTGTTTACC No data
Right 1198887284 X:141353392-141353414 GCAGGGGCATTCATAGCCCTTGG No data
1198887275_1198887282 -9 Left 1198887275 X:141353362-141353384 CCAGGAGGCTGGCCGTGTTTACC No data
Right 1198887282 X:141353376-141353398 GTGTTTACCACTTGGGGCAGGGG No data
1198887275_1198887281 -10 Left 1198887275 X:141353362-141353384 CCAGGAGGCTGGCCGTGTTTACC No data
Right 1198887281 X:141353375-141353397 CGTGTTTACCACTTGGGGCAGGG No data
1198887275_1198887288 24 Left 1198887275 X:141353362-141353384 CCAGGAGGCTGGCCGTGTTTACC No data
Right 1198887288 X:141353409-141353431 CCTTGGTTTCGGAGCAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198887275 Original CRISPR GGTAAACACGGCCAGCCTCC TGG (reversed) Intergenic
No off target data available for this crispr