ID: 1198887281

View in Genome Browser
Species Human (GRCh38)
Location X:141353375-141353397
Sequence CGTGTTTACCACTTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198887266_1198887281 30 Left 1198887266 X:141353322-141353344 CCAGCAGCACAATCCAGGAGTAA No data
Right 1198887281 X:141353375-141353397 CGTGTTTACCACTTGGGGCAGGG No data
1198887275_1198887281 -10 Left 1198887275 X:141353362-141353384 CCAGGAGGCTGGCCGTGTTTACC No data
Right 1198887281 X:141353375-141353397 CGTGTTTACCACTTGGGGCAGGG No data
1198887268_1198887281 17 Left 1198887268 X:141353335-141353357 CCAGGAGTAATTGGTCCTTGATC No data
Right 1198887281 X:141353375-141353397 CGTGTTTACCACTTGGGGCAGGG No data
1198887273_1198887281 2 Left 1198887273 X:141353350-141353372 CCTTGATCAGGGCCAGGAGGCTG No data
Right 1198887281 X:141353375-141353397 CGTGTTTACCACTTGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198887281 Original CRISPR CGTGTTTACCACTTGGGGCA GGG Intergenic
No off target data available for this crispr