ID: 1198887284

View in Genome Browser
Species Human (GRCh38)
Location X:141353392-141353414
Sequence GCAGGGGCATTCATAGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198887273_1198887284 19 Left 1198887273 X:141353350-141353372 CCTTGATCAGGGCCAGGAGGCTG No data
Right 1198887284 X:141353392-141353414 GCAGGGGCATTCATAGCCCTTGG No data
1198887279_1198887284 -5 Left 1198887279 X:141353374-141353396 CCGTGTTTACCACTTGGGGCAGG No data
Right 1198887284 X:141353392-141353414 GCAGGGGCATTCATAGCCCTTGG No data
1198887275_1198887284 7 Left 1198887275 X:141353362-141353384 CCAGGAGGCTGGCCGTGTTTACC No data
Right 1198887284 X:141353392-141353414 GCAGGGGCATTCATAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198887284 Original CRISPR GCAGGGGCATTCATAGCCCT TGG Intergenic
No off target data available for this crispr