ID: 1198887285

View in Genome Browser
Species Human (GRCh38)
Location X:141353398-141353420
Sequence GCATTCATAGCCCTTGGTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198887275_1198887285 13 Left 1198887275 X:141353362-141353384 CCAGGAGGCTGGCCGTGTTTACC No data
Right 1198887285 X:141353398-141353420 GCATTCATAGCCCTTGGTTTCGG No data
1198887283_1198887285 -8 Left 1198887283 X:141353383-141353405 CCACTTGGGGCAGGGGCATTCAT No data
Right 1198887285 X:141353398-141353420 GCATTCATAGCCCTTGGTTTCGG No data
1198887279_1198887285 1 Left 1198887279 X:141353374-141353396 CCGTGTTTACCACTTGGGGCAGG No data
Right 1198887285 X:141353398-141353420 GCATTCATAGCCCTTGGTTTCGG No data
1198887273_1198887285 25 Left 1198887273 X:141353350-141353372 CCTTGATCAGGGCCAGGAGGCTG No data
Right 1198887285 X:141353398-141353420 GCATTCATAGCCCTTGGTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198887285 Original CRISPR GCATTCATAGCCCTTGGTTT CGG Intergenic
No off target data available for this crispr