ID: 1198889169

View in Genome Browser
Species Human (GRCh38)
Location X:141373856-141373878
Sequence CCAATCTATCAGTAAATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198889169_1198889175 -7 Left 1198889169 X:141373856-141373878 CCTGGGATTTACTGATAGATTGG No data
Right 1198889175 X:141373872-141373894 AGATTGGATGTGGGGATTGGAGG No data
1198889169_1198889174 -10 Left 1198889169 X:141373856-141373878 CCTGGGATTTACTGATAGATTGG No data
Right 1198889174 X:141373869-141373891 GATAGATTGGATGTGGGGATTGG No data
1198889169_1198889177 10 Left 1198889169 X:141373856-141373878 CCTGGGATTTACTGATAGATTGG No data
Right 1198889177 X:141373889-141373911 TGGAGGAGTTAGGAGAGATGAGG No data
1198889169_1198889176 0 Left 1198889169 X:141373856-141373878 CCTGGGATTTACTGATAGATTGG No data
Right 1198889176 X:141373879-141373901 ATGTGGGGATTGGAGGAGTTAGG No data
1198889169_1198889178 21 Left 1198889169 X:141373856-141373878 CCTGGGATTTACTGATAGATTGG No data
Right 1198889178 X:141373900-141373922 GGAGAGATGAGGATACAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198889169 Original CRISPR CCAATCTATCAGTAAATCCC AGG (reversed) Intergenic
No off target data available for this crispr