ID: 1198896552

View in Genome Browser
Species Human (GRCh38)
Location X:141461982-141462004
Sequence GATAAAACTGAAGTGCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198896552_1198896559 25 Left 1198896552 X:141461982-141462004 CCTGGATGCACTTCAGTTTTATC No data
Right 1198896559 X:141462030-141462052 TTGCTGGTTTGTTCAGGGGATGG No data
1198896552_1198896555 19 Left 1198896552 X:141461982-141462004 CCTGGATGCACTTCAGTTTTATC No data
Right 1198896555 X:141462024-141462046 TTTACCTTGCTGGTTTGTTCAGG No data
1198896552_1198896556 20 Left 1198896552 X:141461982-141462004 CCTGGATGCACTTCAGTTTTATC No data
Right 1198896556 X:141462025-141462047 TTACCTTGCTGGTTTGTTCAGGG No data
1198896552_1198896557 21 Left 1198896552 X:141461982-141462004 CCTGGATGCACTTCAGTTTTATC No data
Right 1198896557 X:141462026-141462048 TACCTTGCTGGTTTGTTCAGGGG No data
1198896552_1198896554 9 Left 1198896552 X:141461982-141462004 CCTGGATGCACTTCAGTTTTATC No data
Right 1198896554 X:141462014-141462036 ATGGACAAAATTTACCTTGCTGG No data
1198896552_1198896553 -10 Left 1198896552 X:141461982-141462004 CCTGGATGCACTTCAGTTTTATC No data
Right 1198896553 X:141461995-141462017 CAGTTTTATCATCTATGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198896552 Original CRISPR GATAAAACTGAAGTGCATCC AGG (reversed) Intergenic