ID: 1198896556

View in Genome Browser
Species Human (GRCh38)
Location X:141462025-141462047
Sequence TTACCTTGCTGGTTTGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198896552_1198896556 20 Left 1198896552 X:141461982-141462004 CCTGGATGCACTTCAGTTTTATC No data
Right 1198896556 X:141462025-141462047 TTACCTTGCTGGTTTGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198896556 Original CRISPR TTACCTTGCTGGTTTGTTCA GGG Intergenic