ID: 1198897029

View in Genome Browser
Species Human (GRCh38)
Location X:141466779-141466801
Sequence CTATTTCAGAACCTACTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198897029_1198897034 23 Left 1198897029 X:141466779-141466801 CCCACAAGTAGGTTCTGAAATAG No data
Right 1198897034 X:141466825-141466847 AAATACTGTAGTTTCTCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198897029 Original CRISPR CTATTTCAGAACCTACTTGT GGG (reversed) Intergenic
No off target data available for this crispr